Production of Cas9 mRNA and sgRNA

The T7 promoter was added to Cas9 and sgRNA by PCR amplification of px260 (Addgene, Watertown, MA, USA) and px330 (Addgene, Watertown, MA, USA) using the primers listed in Table 1. The T7-Cas9 PCR product was purified and used as the template for in vitro transcription (IVT) using the mMESSAGE mMACHINE T7 Ultra Kit (Ambion, Austin, Texas, USA), and the T7-sgRNA PCR product was purified and used as the template for IVT using the MEGAshortscript^TM High Transcription Kit (Ambion, Austin, Texas, USA) according to the manufacturer’s instructions. Both Cas9 mRNA and sgRNA were purified using the MEGA Clear Kit (Ambion, Austin, Texas, USA) according to the manufacturer’s instructions and eluted in RNase-free water.

sgRNA sequence and the primers used to generate the templates for gRNA and Cas9 in vitro transcription.

TAATACGACTCACTATAGGGAGACTAGAGAGGCTCAATTCG

TTTTAGAGCTAGAAATAG