Cloning sgRNA using BbsI

• TOP and BOTTOM 20 nt oligos of the target sequence

• sgRNA plasmid with BbsI cloning site (e.g. pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A); pKLV-U6gRNA(BbsI)-PGKpuro2ABFP; pC016 - LwCas13a guide expression backbone with U6 promoter)
  

• sequencing oligo LK0.1 5' (GACTATCATATGCTTACCGT)

• T4 DNA ligase + buffer

• T4 PNK
  

• Buffer Tango

• DTT (10mM)

• ATP (10mM)

• BbsI restriction enzyme

• Nuclease free water
  

• 0.2 ml PCR tubes

• PCR machine
  

• Prepare 100μM stock solution (in water) of TOP and BOTTOM oligos.

• Annealing -  prepare the following mix in 0.2ml PCR tube:

• In the PCR machine, use the following steps: 37°C 30min → 95°C 5min → cool to 25°C at a rate of 5°C/min.

• Dilute annealed oligo 1:200 in water

• Cloning -  prepare the following mix in 0.2ml PCR tube:

• Incubate, in the PCR machine, using the following steps: 37°C 5min → 21°C 5min, repeat for 6 cycles.

• Transform 2-5 μl of the reaction to E. coli.

• Verify correct cloning and insertion by plasmid prep from single colonies and sequencing using oligo LK0.1 5'
  

Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA & Zhang F (2013) Genome engineering using the CRISPR-Cas9 system.   Nature Protocols 8(11): 2281-2308.