×
Please leave your comments or questions
 

Cloning sgRNA using BbsI

Author: Gal Haimovich, updated date: , view: 50, Q&A: 0
Tags: Cloning, CRISPR, Cas9, Cas13a and sgRNA

Materials and Reagents

  • TOP and BOTTOM 20 nt oligos of the target sequence

  • sgRNA plasmid with BbsI cloning site (e.g. pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A); pKLV-U6gRNA(BbsI)-PGKpuro2ABFP; pC016 - LwCas13a guide expression backbone with U6 promoter)

  • sequencing oligo LK0.1 5' (GACTATCATATGCTTACCGT)

  • T4 DNA ligase + buffer

  • T4 PNK

  • Buffer Tango

  • DTT (10mM)

  • ATP (10mM)

  • BbsI restriction enzyme

  • Nuclease free water

Equipment

  • 0.2 ml PCR tubes

  • PCR machine

Procedure


  • Prepare 100μM stock solution (in water) of TOP and BOTTOM oligos.

  • Annealing -  prepare the following mix in 0.2ml PCR tube:


TOP oligo1 μl
Bottom oligo 1 μl
T4 DNA ligase buffer1 μl
T4 PNK1 μl
water6 μl
  • In the PCR machine, use the following steps: 37°C 30min → 95°C 5min → cool to 25°C at a rate of 5°C/min.

  • Dilute annealed oligo 1:200 in water

  • Cloning -  prepare the following mix in 0.2ml PCR tube:



Reagentvolume/amount
plasmid DNA100ng
Annealed oligos2 μl
Restriction buffer Tango2 μl
DTT 10mM1 μl
ATP 10mM1 μl
T4 DNA ligase0.5 μl
BbsI
1 μl
WaterComplete to 20 μl
Total:20 μl
  • Incubate, in the PCR machine, using the following steps: 37°C 5min → 21°C 5min, repeat for 6 cycles.

  • Transform 2-5 μl of the reaction to E. coli.

  • Verify correct cloning and insertion by plasmid prep from single colonies and sequencing using oligo LK0.1 5'



References

Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA & Zhang F (2013) Genome engineering using the CRISPR-Cas9 system.   Nature Protocols 8(11): 2281-2308.

Comment
Please login to post your questions/comments. Your questions will be directed to the authors of the protocol. The authors will be requested to answer your questions at their earliest convenience. Once your questions are answered, you will be informed using the email address that you register with bio-protocol.
You are highly recommended to post your data including images for the troubleshooting.
You are highly recommended to post your data (images or even videos) for the troubleshooting. For uploading videos, you may need a Google account because Bio-protocol uses YouTube to host videos.