Materials and Reagents
TOP and BOTTOM 20 nt oligos of the target sequence
sgRNA plasmid with BbsI cloning site (e.g. pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A); pKLV-U6gRNA(BbsI)-PGKpuro2ABFP; pC016 - LwCas13a guide expression backbone with U6 promoter)
sequencing oligo LK0.1 5' (GACTATCATATGCTTACCGT)
T4 DNA ligase + buffer
T4 PNK
Buffer Tango
DTT (10mM)
ATP (10mM)
BbsI restriction enzyme
Nuclease free water
Equipment
0.2 ml PCR tubes
PCR machine
Procedure
Prepare 100μM stock solution (in water) of TOP and BOTTOM oligos.
Annealing - prepare the following mix in 0.2ml PCR tube:
In the PCR machine, use the following steps: 37°C 30min → 95°C 5min → cool to 25°C at a rate of 5°C/min.
Dilute annealed oligo 1:200 in water
Cloning - prepare the following mix in 0.2ml PCR tube:
Incubate, in the PCR machine, using the following steps: 37°C 5min → 21°C 5min, repeat for 6 cycles.
Transform 2-5 μl of the reaction to E. coli.
Verify correct cloning and insertion by plasmid prep from single colonies and sequencing using oligo LK0.1 5'
References
Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA & Zhang F (2013) Genome engineering using the CRISPR-Cas9 system. Nature Protocols 8(11): 2281-2308.