RNA isolation was performed using RNAiso Plus (TAKARA BIO INC., Shiga, Japan) according to the manufacturer’s instruction. Reverse transcription was performed using ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO Co., Osaka, Japan). Genomic DNA (gDNA) isolation was performed using DNeasy Blood & Tissue Kits (TAKARA) according to the manufacturer’s instruction. Quantitative PCR (qPCR) was performed using THUNDERBIRD SYBR qPCR Mix (TOYOBO Co.) and StepOnePlus Real-Time PCR System (Thermo Fisher Scientific). The temperature profile of real-time PCR was 95°C for 60 s, followed by 40 cycles of 95°C for 10 s and 60°C for 30 s. The following primer sequences were used according to PrimerBank (https://pga.mgh.harvard.edu/primerbank/) (55): mouse beta actin (GenBank Accession: NM_007393): Actb_fwd GGCTGTATTCCCCTCCATCG, Actb_rev CCAGTTGGTAACAATGCCATGT; mouse C3 (NM_009778): C3_fwd CCAGCTCCCCATTAGCTCTG, C3_rev GCACTTGCCTCTTTAGGAAGTC; mouse C3aR (NM_009779): C3ar1_fwd TCGATGCTGACACCAATTCAA, C3ar1_rev TCCCAATAGACAAGTGAGACCAA; mouse C5aR1 (NM_007577): C5ar1_fwd CATACCTGCGGATGGCATTCA, C5ar1_rev GGAACACCACCGAGTAGATGAT; mouse C1qa (NM_007572): C1qa_fwd AAAGGCAATCCAGGCAATATCA, C1qa_rev TGGTTCTGGTATGGACTCTCC; mouse complement factor P (properdin) (NM_008823): Cfp_fwd TTCACCCAGTATGAGGAGTCC, Cfp_rev GCTGACCATTGTGGAGACCT; mouse complement factor B (FB) (NM_008198): Cfb_fwd GAGCGCAACTCCAGTGCTT, Cfb_rev GAGGGACATAGGTACTCCAGG; mouse complement factor H (FH) (NM_009888): Cfh_fwd AGGCTCGTGGTCAGAACAAC, Cfh_rev GTTAGACGCCACCCATTTTCC; C4b- binding protein (C4BP) (NM_007576): C4bp_fwd ACAAGAGCTGCACATGGGAG, C4bp_rev GGCATTGGGTATAGCAGGTGG. The following primer sequences were used for gDNA quantification: mouse beta actin: Actb_fwd TGTCTTGATAGTTCGCCATGGA, Actb_rev TACAGCCCGGGGAGCATCGT; T. gondii B1: TgB1_fwd TCTCTCAAGGAGGACTGGCA, TgB1_rev GTTTCACCCGGACCGTTTAG.
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.