Inhibition of gene expression, and overexpression

ERF shRNA knockdown experiments were performed by infection and puromycin selection of cells with lentivirus containing the miR-E based SGEP or SGEN vectors²⁴ gifted by J. Zuber containing the following guide sequences: shErf_m: TTGAACTTGTAGGTGAACCGTT, shERF_2: TTGTTTTGAATACATTCTCCAG, shERF_1: TTGAAATTGAACTTGTAGGTGA, shNT was previously described as Ren.713 targeting Renilla luciferase²⁴. ERG shRNA knockdown experiments were performed by infection and neomycin selection of cells with lentivirus containing the Tet-pLKO-neo vector gifted by D. Wiederschain (Addgene plasmid 21916) using the previously published ERG shRNA and non-targeting sequences²⁵. For Tet-responsive reporters, either dimethylsulfoxide (DMSO) vehicle or doxycycline (Sigma) was added at 100 ng ml⁻¹. CRISPR–Cas9 experiments were performed by infection and puromycin selection of cells with lentivirus containing the lentiCRISPRv2 vector gifted by F Zhang (Addgene plasmid 52961) containing the following guide sequences chosen via the http://www.genome-engineering.org website: sgERG (GATAACTCTGCGCTCGTTCG), sgERFm (CCTGCCAAGCGATGACGCCC), and previously described sgNT²⁶. Overexpression of cDNAs was achieved by the constitutive or Tet-inducible pLV-based lentiviral expression system.