request Request a Protocol
ask Ask a question
Favorite

Total RNA was isolated from HUVECs using Trizol reagent, according to the manufacturer’s protocol. The integrity of the RNA samples was checked by agarose gel electrophoresis. The total RNA was reverse-transcribed into cDNA using a reverse transcription kit, followed by quantitative PCR to detect the expression levels of SIRT1, CD40 and NF-κB. β-Actin was used as an internal control. The thermal cycling conditions were as follows: 30 s at 95°C for the activation of Taq DNA polymerase, followed by 40 cycles of amplification at 95°C for 15 s, 1 min at 60°C, and 1 min at 72°C. The reactions were run in triplicate. The specific oligos used in the real-time PCR were as follows: SIRT1 (forward): 5ʹ-GATTAGTAGGCGCTT GATGGT-3ʹ, SIRT1 (reverse): 5ʹ-TCTTCTAAACTTGGACTCGGCAT-3ʹ, CD40 (forward): 5ʹ-A CACTGCCACCAGCACAAATAC-3ʹ, CD40 (reverse): 5ʹ- GATAAAGACCAGCACCAAGAGGAT-3ʹ, NF-κB (forward): 5’ AGTTTGACGGTGAGCTGGTA 3’, NF-κB (reverse): 5’ GCCTCGGCCTGCCGCAAGCCT3’, β-actin (forward): 5ʹ-TGGCACCCAGCACAATGAA-3ʹ, β-actin (reverse): 5ʹ-CTAAGT CATAGTCCGCCTAGAAGCA-3ʹ. Gene expression values were calculated by the 2 -ΔΔCT relative expression method.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A