RT–PCR analyzes

Total RNA was isolated by TriReagent (Molecular Research Center). A total of 1 μg of total RNA isolated from heart samples of control or DM individual was subjected to reverse transcription using random hexanucleotide and the Transcriptor High Fidelity cDNA synthesis kit (Roche Diagnostics). PCR was performed with Taq polymerase (Roche), using the following protocol: one denaturation step at 94 °C for 2 min, 30 cycles of amplification 94 °C for 1 min, 60 °C for 1 min, 72 °C for 2 min and a final step at 72 °C for 5 min using primers described in the Supplementary Table 4. The PCR products were precipitated, analysed by electrophoresis on a 6.5% polyacrylamide gel, stained with ethidium bromide and quantified using a PhosphorImager Typhoon scanner (GE Healthcare) and the ImageQuaNT software. Concerning analysis of alternative splicing of human SCN5A, the forward primer was located within SCN5A exon 5 (FWD: 5′- CTTCTGCCTGCACGCGTTCAC -3′) and the reverse primer within SCN5A exon 7 (REV: 5′- CAGAAGACTGTGAGGACCATC -3′). Since SCN5A exons 6A or 6B are of similar size (92 nts), PCR products were digested by BstBI enzyme before loading on 6.5% polyacrylamide gel, resulting in PCR products of 240 bp (exon 6B) and a doublet of 115 bp and 125 bp (exon 6A digested by BstBI).