Peptide-Expressing Plasmids

pSC11 plasmids containing Venus/mCherry-ubiquitin-peptide cassettes were obtained from J. Bennink. These plasmids were used in Ref. (35) to generate recombinant vaccinia viruses expressing the following peptides: SSLENFRAYV, PA_224–233 and ASNENMETM, NP_366–374. To be able to use those constructs in transient transfection assays the cassettes were recloned into pEGFP-Ub-SIINFEKL (36) (obtained from J. Neefjes). Venus/mCherry-Ub-peptide cassettes were amplified from the pSC11 plasmids by PCR using primers CGCTAGCGCTACCGGTCGCCACCATGGTGAGCAAGGGCGAG and CGCTCACAGAATTCCCAGCG containing a Nhe1 and EcoR1 restriction sites respectively (underlined). The PCR product was amplified using GoTaq Flexi DNA Polymerase (Promega) to enable ligation into the pGEM-T vector system (Promega). pGEM-T-cassette plasmid sequences were checked by sequencing using SP6 and T7 promoter primers. pGEM-T-cassette and pEGFP-Ub-SIINFEKL plasmids were then cut with Nhe1 and EcoR1 and the EGFP-Ub-SIINFEKL cassette was replaced with the Venus/mCherry-Ub-peptide cassette using the Roche Rapid Ligation Kit (Roche). Resulting plasmids were checked by sequencing using the above primers.