A protocol based on Tris-KCl-EDTA (TKE) [Tris–HCl 100 mM, pH 9.5, KCl 1 M, EDTA 10 mM] buffer, originally developed for plant tissue, had been adapted [33] to extract DNA from single DNA Amaranthus seeds. The protocol avoids the use of liquid nitrogen and toxic chemicals, plus it is carried out at room temperature and with no incubation time. Single seeds were ground with two bearing beads (4 mm diameter) in 2 mL vials by using Tissuelyser II (Qiagen, Hilden, Germany). Six hundred μL of extraction buffer were added after grinding, then beads were removed. Samples were then centrifuged for 5 min at 10,000 rpm to precipitate the debris. The aqueous phase of all samples was transferred into new vials and added with an equal volume of cold isopropanol. Vials were centrifuged at 10,000 rpm for 5 min and then supernatant was gently poured off to avoid losing the very scarce pellet at the bottom. Two hundred µL of 70% ethanol were used to wash pellets. Pellets were then allowed to air dry until complete ethanol evaporation and then re-suspended in 30 μL of water. DNA quality was determined with Nanodrop 2000c (Thermo Fisher Scientific, Waltham, MA, USA).
The genomic DNA was extracted from seeds of six accessions (namely, 20, 34, 42, 45, 49 and 56) approximately spanning the sampling area (three seeds each) and the ALS gene was partially amplified to look for point mutations at position 574. Primers AMA-2F (TCCCGGTTAAAATCATGCTC) and AMA-2R (CTTCTTCCATCACCCTCTGT) were used to amplify a region 337 bp following a previously described procedure [13] adapting volumes to seed-extracted gDNA. PCR was performed using GoTaq® G2 Hot Start Polymerase (Promega, Madison, WI, USA) in a 50 µL mixture including 10 µL of 5X Green GoTaq Flexi Buffer, dNTPs mix (0.2 mM each), MgCl2 (1.5 mM), forward and reverse primers (0.2 µM), 0.25 µL GoTaq DNA Polymerase (5 U/µL) and 3 uL of seed-extracted gDNA (approximately 30 ng). Amplification conditions: 2 min at 95 °C; 30 cycles of 30 s at 95 °C, 30 s at 58 °C, 30 s at 72 °C; 5 min at 72 °C. Amplicons were purified using NucleoSpin® Gel and PCR Clean-up kit (Macherey-Nagel GmbH & Co., Duren, Germany) following manufacturer’s instructions and Sanger sequenced (BMR Genomics, Padua, Italy).
An allele-specific PCR assay (PASA) utilizes primers designed to selectively bind to only one allele [34] and is a widely adopted resistance detection technique [35]. Primer specificity is due to the presence of a nucleotide exactly matching one of the alleles but not the other. An allele-specific PCR assay was developed by using seed-extracted gDNA to rapidly detect the presence of the ALS mutant alleles leucine and methionine at position 574 among the accessions with survival rate to thifensulfuron-methyl higher than 25% (Section 4.2). Allele-specific primers (Table 1) were designed to recognize the wild type codon tryptophan and the two resistance-endowing allelic variants. To test the PASA specificity, three accessions described in the previous step (see Section 4.4.2) were used as reference samples positive for leucine, tryptophan or methionine, respectively; four samples each were amplified using all primer combinations, and then amplicons were visualized on 1% agarose gel. PASA were performed at similar conditions to that described for ALS amplification, with slight modifications: final volume 15 μL, DNA 1 μL (approximately 10 ng), annealing temperature 60 °C, elongation time 50 s. Once PASA specificity was verified, the presence of the two resistance-endowing alleles leucine and methionine was investigated across the selected populations (51). Genomic DNA was extracted from four seeds per accession as described in Section 4.4.1. All samples were amplified with two allele-specific PCR: one for the leucine allele and one for the methionine (204 PCR each, 408 in total). The PCR amplifications were run on 1% agarose gel: samples giving amplification with both primers were determined as positive for both leucine and methionine, while those giving no amplification were assumed to have no mutant alleles.
Sequence of primers used for the allele-specific assay (PASA). An additional mismatch (A → C, underlined) was introduced to increase primer specificity, but at the third-to-last base of the primers instead of the penultimate base as elsewhere suggested [36].
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.