Y-haplogroups determination

All the participants were genotyped for single nucleotide polymorphisms (SNPs) that defined the most common European Y-haplogroups (Table 2). The nucleotides were determined by real-time PCR with Taqman assays in an ABI7500 equipment and following the manufacturer instructions (Fisher Scientific). The allele frequencies among Europeans were obtained from the Ensembl database (www.ensembl.org).

The 9 single nucleotide polymorphisms determined to define the Y-haplogroups, genotyped with Taqman assays (Fisher scientific) or Sanger sequencing of PCR fragments (R1b-DF27)

rs2032597A/C

rs111665403 A/G

C_1083231_10

Sanger sequencing

C (0.14)

G (0.14)

The frequency of each allele that defines the haplogroups among Europeans was obtained from the Ensembl portal (www.ensembl.org)

The genotyping of the DF27 sub-clade (SNP rs577478344 A/G) was performed by PCR with primers specific for the target region 5′TGTTAAAGTCCTGCGCTATTATGGTGT and 5′AAATATAGACGAATGCATAACTAGAATAACC, followed by Sanger sequencing in a capillary electrophoresis equipment (ABI3130xl, Thermo Fisher) (Suppl. Figure 1).

The presence of haplogroup I was confirmed by Sanger sequencing of PCR fragments containing the rs111665403 SNP, in complete linkage disequilibrium with rs2032597 (Suppl. Figure 2).