2.2. Preparation of 3H‐2‐DG‐labelled CD93hi and CD93lo MΦ

CS Chen Su
YH Yeming Han
BQ Bin Qu
CZ Chao Zhang
TL Ting Liang
FG Feng Gao
GH Guihua Hou
request Request a Protocol
ask Ask a question
Favorite

Preparation of CD93hi MΦ: MΦ were isolated from the peritoneal cavity of naive SD rats with RPMI 1640 medium at 72 h post 6% potato starch intraperitoneal injection. After removal of non‐adherent cells after culture in a humidified incubator (37°C, 5% CO2) for 1 h, cells were stimulated with either Lipopolysaccharide (LPS, 0.1 μg/ml; Sigma) in RPMI‐10% foetal bovine serum, (Invitrogen, FBS) for 12 h (CD93 high expression, CD93hi), or without LPS stimulation (CD93 lower expression, CD93lo) as a control.

Expression of CD93: For reverse‐polymerase chain reaction (RT‐PCR), TRIZOL reagent (Invitrogen) was used to extract total RNA from MΦ to determine its concentration. cDNA was obtained through TransScript One‐Step gDNA Removal and cDNA Synthesis SuperMix (TRANSGENBIOTECH). Target DNA was separated by 1.5% agarose gel electrophoresis and analysed by Image J. CD93 primers were as follows: 5′‐TGCCCCACTCAAGATGCTG‐3′ (forward) and 5′‐CGCTTGCGATAGACCAGTAGC‐3′(reverse).

For Western blot, MΦ were lysed with RIPA lysate (Servicebio) to obtain a protein suspension. Total protein (20 μg) was subjected to gel electrophoresis (Bio‐Rad gel, Bio‐Rad Laboratories) at 80 mV for 30 min and then 120 mV for another 30 min. Total protein was transferred to a polyvinylidene fluoride at 200 mA for 90 min, followed by blocking by 5% skimmed milk powder for 2 h at room temperature. The antibodies used were (i) mouse anti‐mouse CD93 monoclonal antibody (1:200 dilution, Santa, America), (ii) rabbit anti‐mouse GAPDH polyclonal antibody (1:10 000 dilution, Abcam, UK) and (iii) goat anti‐mouse and goat anti‐rabbit secondary antibodies (1:10 000 dilution, Abcam, UK). The protein was quantitatively analysed with a Tanon 4200 imaging system (Tanon Science and Technology Co., Ltd., Shanghai, China).

Labelling with 3H‐2‐DG (2‐deoxyglucose): 40 MBq 3H‐2‐DG (Specific Activity, 0.74 TBq/mmol, China Isotope & Radiation Corporation) in RPMI 1640 medium was added into groups of CD93hi and CD93lo MΦ (1.5 × 108 cells), and cultured at 37℃, 5% CO2 for 2 h. The supernatant was discarded, and the pellet was washed with PBS (phosphate buffered saline). Finally, MΦ were re‐suspended in 200 μl PBS and added to 4 ml of scintillation fluid (ULTIMA GOLD™). Radioactivity (cpm, counts per minute) was measured with a Wizardm1470 (PE) liquid scintillator. Ex vivo 72 h stability in RPMI 1640 and FBS was tested for 3H‐2‐DG‐labelled CD93hi and CD93lo MΦ. As mentioned above labelling with 3H‐2‐DG, 1 ml RPMI 1640 and FBS was added into the wells after washing with PBS and cells were collected after 72 h to measure radioactivity.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A