2.9. Construction of CRISPR interference vector

Single guide RNA (sgRNA) targeting the promoter region of Lnc‐PINK1‐2:5 was designed using CHOPCHOP (https://chopchop.cbu.uib.no/). 12 Lnc‐PINK1‐2:5 sgRNA 5′‐ GTGCTGTGGAAAGAAAGGAGGGG ‐ 3′ was cloned into the lentiGuide‐Puro vector (Addgene, Cat# 52963, Watertown, MA, USA) for expressing hU6‐driven sgRNA using BsmBI sites as described in. 13 5′ ‐ GGTGGTAGAATAACGTATTAC – 3′ was used as the sgRNA control sequence as previously described. 10