To target human Fis1, oligos encoding a guide RNA (gRNA) against Fis1 (gRNA sequence: AGACACCAGCTCGTTCAGCA) was designed using the ATUM tool (https://www.atum.bio/eCommerce/cas9/input) and cloned into the plasmid pSpCas9(BB)‐2A‐Puro (Addgene #62988), which expresses both a gRNA and Cas9, and confers puromycin resistance on transfected cells. HeLa cells were transfected with the gRNA for 48 h, before being treated with puromycin (2 μg/ml; Sigma) for a further 48 h. Cells were then changed into media lacking puromycin and grown until 80% confluent. Clones originating from individual cells were then generated by limiting dilution into 96‐well plates, expanded and tested for Fis1 loss by Western blotting. One Fis1 lacking clone, denoted 2‐1‐3, was used for the experiments shown here.
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.