16S rRNA Illumina high throughput sequencing

The microbial community was assessed using high throughput 16S rRNA sequencing using an Illumina MiSeq platform. First, the DNA was extracted from biomineral and liquid samples using Qiagen DNeasy PowerSoil kits following the manufacturer’s instructions. Primers 319F (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG(spacer)GTACTCCTACGGGAGGCAGCAGT) and 806R (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG(spacer)CCGGACTACNVGGGTWTCTAAT were used to amplify the V3-V4 domain of the 16S rRNA using a twostep PCR procedure. The ureC-F and ureC-R primers used were the same as those described in the previous section.

In step one of the amplification procedure, both forward and reverse primers contained an Illumina tag sequence, a variable length spacer (no spacer, C, TC, or ATC for 319F; no spacer, G, TG, ATG for 806R) to increase diversity and improve the quality of the sequencing run, a linker sequence, and the 16S target sequence. Each 25 mL PCR reaction contained 1 Unit Kapa2G Robust Hot Start Polymerase (Kapa Biosystems), 1.5 mM MgCl₂, 0.2 mM final concentration dNTP mix, 0.2 mM final concentration of each primer and 1 uL of DNA for each sample. PCR conditions for 16S rRNA amplification were: an initial incubation at 95°C for 3 min, followed by 25 cycles of 95°C for 45 s, 50°C for 30 s, 72°C for 30 s and a final extension of 72°C for 3 min. In step two, each sample was barcoded with a unique forward and reverse barcode combination using forward primers (AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCGTCGGCAGCGTC) with an Illumina P5 adapter sequence, a unique 8 nt barcode (N), a partial matching sequence of the forward adapter used in step one, and reverse primers (CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGG) with an Illumina P7 adapter sequence, unique 8 nt barcode (N), and a partial matching sequence of the reverse adapter used in step one. The PCR reaction in step two contained 1 Unit Kapa2G Robust Hot Start Polymerase (Kapa Biosystems), 1.5 mM MgCl₂, 0.2 mM final concentration dNTP mix, 0.2 mM final concentration of each uniquely barcoded primer and 1 uL of the product from the PCR reaction in step one diluted at a 10:1 ratio in water. PCR conditions were: an initial incubation at 95°C for 3 min, followed by 9 cycles of 95°C for 30 s, 58°C for 30 s, 72°C for 30 s and a final extension of 72°C for 3 min.

The final product was quantified on the Qubit instrument using the Qubit Broad Range DNA kit (Invitrogen) and individual amplicons were pooled in equal concentrations. The pooled library was cleaned utilizing Ampure XP beads (Beckman Coulter) then the band of interest was further subjected to isolation via gel electrophoresis on a 1.5% Blue Pippin HT gel (Sage Science). The library was quantified via qPCR followed by 300-bp paired-end sequencing using an Illumina MiSeq instrument in the Genome Center DNA Technologies Core, University of California, Davis.