Ribosome profiling and data analysis

YM Yoshitaka Matsuo
KI Ken Ikeuchi
YS Yasushi Saeki
SI Shintaro Iwasaki
CS Christian Schmidt
TU Tsuyoshi Udagawa
FS Fumiya Sato
HT Hikaru Tsuchiya
TB Thomas Becker
KT Keiji Tanaka
NI Nicholas T. Ingolia
RB Roland Beckmann
TI Toshifumi Inada
request Request a Protocol
ask Ask a question
Favorite

Library preparation was performed according to the method previously described59 with following modifications. The whole cell lysate containing 20 μg of total RNA was treated with 10 units of RNase I (Epicentre) at 24 °C for 45 min. A linker DNA, 5′-(Phos)NNNNNIIIIITGATCGGAAGAGCACACGTCTGAA(ddC)-3′, where (Phos) indicated 5′ phosphoryaltion and (ddC) indicates a terminal 2′,3′-dideoxycytidine, was used. The Ns and Is indicate random barcode for eliminating PCR duplication and multiplexing barcode, respectively. The linkers were pre-adenylated with 5′ DNA Adenylation kit (NEB), and then used for the ligation reaction. Un-reacted linkers were digested by 5′ deadenylase (NEB) and RecJ exonuclease (epicentre) at 30 °C for 45 min. An oligo 5′-(Phos)NNAGATCGGAAGAGCGTCGTGTAGGGAAAGAG(iSp18)GTGACTGGA GTTCAGACGTGTGCTC-3′, where (Phos) indicated 5′ phosphorylation and Ns indicate random barcode, was used for reverse transcription. PCR was performed with oligos, 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′, where Js indicate reverse complement of the index sequence discovered during Illumina sequencing.

The libraries were sequenced on a HiSeq 2000/4000 (Illumina). Reads were mapped to reporter sequence and yeast transcriptome, removing duplicated read based on random barcode sequences. The analyses were restricted to 20–22 and 27–29 nt long reads. We empirically estimated the position of A-site from 5′-end of the reads based on the length of each footprint. The offsets were 16 for 22 and 29 nt reads and 15 for 20, 21, and 28 nt reads, and 14 for 27 nt reads.

Ribosome pause scores of short and long footprints were calculated as previously published60. Basically, we took short or long footprints accumulation over the average of the footprint density in the given ORFs avoiding first and last five codons. Analyses were restricted to the mRNAs with 0.5 footprints/codon and more. The averaged pause scores of short and long footprints on given di-codons were computed. For metagene analysis, we defined polybasic tract as the amino acid sequence with six or more arginine or lysine in 10 amino acid window, as previously published2.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A