Real-time quantitative polymerase chase reaction (qPCR)

Primers for qPCR were designed to detect the relative copy number of targeted genes within the aberrations and to avoid any potential common genomic variants encountered in the general population reported in the Database of Genomic Variants. The SYBR green assay (Thermo Fisher Scientific) was performed on BMPER (BMP Binding Endothelial Regulator) in the deleted region and XYLT1 (Xylosyltransferase 1) in the duplicated region, using RPPH1 (Ribonuclease P RNA Component H1) and TERT (Telomerase Reverse Transcriptase) genes as references. The relative copy number was calculated using the ∆∆C_t method compared to an unaffected human DNA sample. Primers used for qPCR were as follows: BMPER-forward: ctgtggtttgcaagaggaag, BMPER-reverse: atgtcttctgggggcactc, XYLT1-forward: caacgagtccagccatcc, XYLT1-reverse: cagagcttccagagcctaaac, TERT-E3-forward: tcccacgacgtagtccat, TERT-E3- reverse: cagaggtca-ggcagcatc, RNaseP-forward: ggagagtagtctgaattgggttatg, and RNaseP-reverse: ggagcttggaaca-gactcac.