Published: Vol 5, Iss 19, Oct 5, 2015 DOI: 10.21769/BioProtoc.1604 Views: 21359
Reviewed by: Arsalan DaudiFang XuAnonymous reviewer(s)

Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
Related protocols

Laser-Assisted Microdissection and High-Throughput RNA Sequencing of the Arabidopsis Gynoecium Medial and Lateral Domains
Valentín Luna-García and Stefan de Folter
Sep 5, 2024 2103 Views

A Microplate-Based Expression Monitoring System for Arabidopsis NITRATE TRANSPORTER2.1 Using the Luciferase Reporter
Yoshiaki Ueda and Shuichi Yanagisawa
Dec 5, 2024 1811 Views

A Novel Gene Stacking Method in Plant Transformation Utilizing Split Selectable Markers
Guoliang Yuan [...] Xiaohan Yang
Feb 20, 2025 2014 Views
Abstract
Production of functional eukaryotic RNA is a very elaborate process that involves a complex interplay between transcription and various RNA processing activities, including splicing, 5’ capping, and 3’ cleavage and polyadenylation (Bentley, 2014). Accurate mapping of RNA ends provides a valuable tool to assess transcriptional and post-transcriptional events giving rise to different gene transcripts. The abundance of such transcripts most likely depends on exogenous and developmental cues, or mutations. In the reference plant Arabidopsis, perturbation of the HUA-PEP post-transcriptional regulatory factors (Rodríguez-Cazorla et al., 2015) leads to the accumulation of aberrant transcripts of the key floral homeotic gene AGAMOUS (AG) (Yanofsky et al., 1990) that retain intronic sequence. It was determined by 3’ RACE reactions that such erroneous transcripts correspond to premature processing and polyadenylation events taking place at the AG intron region. Here we describe a protocol that is suitable for analysis of relatively abundant transcripts and also for detecting aberrant RNA species that are likely prone to rapid turnover. Likewise, the method, here adapted to Arabidopsis reproductive tissues, can be applied to characterize RNA species from other organs (leaf, root) and/or other plant species. We provide a detailed protocol of our 3’ RACE procedure comprising four major parts: Total RNA extraction, RNA amount determination and quality control, the RACE procedure itself, and isolation of the resulting RACE products for cloning and sequencing.
Keywords: ArabidopsisMaterials and Reagents
Equipment
Procedure
| 1 cycle | 94 °C, 2 min |
| 35 cycles | 94 °C, 30 sec; 51 °C, 30 sec; 72 °C, 30 sec |
| 1 cycle | 72 °C, 10 min |
Representative data
Table 1. Oligonucleotides used in this study
| Name | Sequence (5’ – 3’) | References |
| Oligo d(T)-Anchor Primer | GACCACGCGTATCGATGTCGACTTTTTTTTTTTTTTTTV | Roche 5’/3’ RACE Kit |
| PCR Anchor Primer | GACCACGCGTATCGATGTCGACRoche | 5’/3’ RACE Kit |
| ACT2-f | CTCTTAACCGTAAAGCTAACAG | An et al., 1996 |
| ACT2-r | AGTGAGAATCTTCATGAGTGAG | An et al., 1996 |
| AGIa (specific forward primer) | CGGATCGAGAACACAACGAATCG | Rodríguez-Cazorla et al., 2015 |
| AGIb (specific forward primer) | GGTTTGCTCAAGAAAGCTTACGAGC | Rodríguez-Cazorla et al., 2015 |




Acknowledgments
This work was supported by grants from Ministerio de Economía y Competitividad of Spain (https://sede.micinn.gob.es) (grant BIO2014-56321-P to AV) and National Science Foundation of USA (http://www.nsf.gov/; grant IOS-1121055 to MFY) and Paul D. Saltman Endowed Chair in Science Education (http://biology.ucsd.edu/news/awards-and-honors/endowedchairs.html) to MFY.
References
Article Information
Copyright
© 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite
Rodríguez-Cazorla, E., Andújar, A., Ripoll, J. J., Bailey, L. J., Martínez-Laborda, A., Yanofsky, M. F. and Vera, A. (2015). 3’ Rapid Amplification of cDNA Ends (3’ RACE) Using Arabidopsis Samples. Bio-protocol 5(19): e1604. DOI: 10.21769/BioProtoc.1604.
Category
Plant Science > Plant molecular biology > DNA > Gene expression
Plant Science > Plant molecular biology > RNA > Transcription
Molecular Biology > DNA > PCR
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Share
Bluesky
X
Copy link
