Staphylococcus aureus 30S Ribosomal Subunit Purification and Its Biochemical and Cryo-EM Analysis

Materials and Reagents

Cells

Staphylococcus aureus RN6390 strain (Khusainov et al., 2016)

70S ribosome purification

1. Polycarbonate 50 mL centrifuge tubes (Nalgene^TM, catalog number: 3117-0500)

2. Open-top thinwall ultra-clear tube, 38.5 mL (Beckman Coulter, catalog number: 344058)

3. Blood agar plates (BD^TM Columbia agar with 5% sheep blood, catalog number: PA-254005.06)

4. Brain–heart infusion broth (BHI, Sigma-Aldrich, catalog number: 53286)

5. Lysostaphin (Sigma-Aldrich, catalog number: L7386)

6. DNase I (Roche, catalog number: 4716728001)

7. Protease inhibitor cocktail without ethylenediaminetetraacetic acid (EDTA, Thermo Scientific^TM, catalog number: 78429)

8. 30% PEG 20000 (Hampton Research, HR2-609)

9. Buffer A (see Recipes)

10. Buffer B (see Recipes)

11. 5× buffer E (see Recipes)

12. Dissociation buffer (see Recipes)

    
    

30S subunit purification

1. Open-top thinwall ultra-clear tube, 13.2 mL (Beckman Coulter, catalog number: 344059)

2. Amicon ultra-15 centrifugal filter unit (Merck Millipore, catalog number: UFC910008)

3. Liquid nitrogen

4. 30S storage buffer (see Recipes)

   
   

mRNA purification

1. RNaseZap (Thermo Scientific^TM, catalog number: AM9780)

2. NucleoSpin Plasmid, mini kit for plasmid DNA (Macherey-Nagel, catalog number: 740588.50)

3. NucleoSpin Gel and PCR Clean-up, mini kit for gel extraction and PCR clean-up (Macherey-Nagel, catalog number: 740609.50)

4. BamHI enzyme (NEB, catalog number: R0136S)

5. CutSmart^® buffer (NEB, catalog number: B7204S)

6. MEGAscript kit with DNase turbo (Ambion, catalog number: AM1333)

7. ROTI^® phenol/chloroform/isoamyl alcohol, 250 mL, pH 7.5–8.0 (Carl Roth, catalog number: A156.1)

8. ROTI^® Aqua-P/C/I, 250 mL, pH 4.5–5.0 (Carl Roth, catalog number: X985.1)

9. 3 M sodium acetate

10. Buffer ELU (see Recipes)

    
    

30S and mRNA quality analysis

1. PageRuler^TM protein ladder (Thermo Scientific^TM, catalog numbers: 26616 and 26619)

2. InstantBlue^® coomassie protein stain (Abcam, catalog number: ab119211)

3. ROTI^® aqua-phenol, 250 mL, pH 4.5–5.0 (Carl Roth, catalog number: A980.1)

4. Chloroform (Thermo Scientific^TM, catalog number: AC158210010)

5. Agarose (SeaKem^TM, catalog number: 11590717)

6. 1 M potassium thiocyanate (Sigma, catalog number: P3011)

7. Ethidium bromide (Thermo Scientific^TM, catalog number: 15585011)

8. 100% formamide (Sigma, catalog number: F9037)

9. RiboRuler low-range RNA ladder (Thermo Scientific^TM, catalog number: SM1831)

10. 4% stacking gel (see Recipes)

11. 15% resolving gel (see Recipes)

12. 4× blue buffer (see Recipes)

13. 10× running buffer (see Recipes)

14. 6% polyacrylamide gel (see Recipes)

15. 10× TBE (see Recipes)

    
    

Toeprinting assay

1. 10 μM Toe primer (5′ CCTGCAGGTCGACTC 3′)

2. 10× PNK buffer (Thermo Scientific^TM, catalog number: EK 0032)

3. 10 U/μL T4 PNK (Thermo Scientific^TM, catalog number: EK 0032)

4. [γ-³²P]-ATP (370 MBq/mL, 10 mCi/mL, 185 MBq)

5. Micro bio-spin chromatography columns (Bio-Rad, catalog number: 732-6200)

6. 20 U/μL AMV reverse transcriptase, isolated from Avian Myeloblastosis Virus (QBIOgene, catalog number: EMAMV200)

7. 10× AMV buffer (QBIOgene, catalog number: EMAMV200)

8. 10 mM dATP, dCTP, dGTP, and dTTP (Roche, catalog numbers: 11051440001, 11051458001, 11051466001, and 11051482001)

9. 0.3 M Na acetate (Sigma, catalog number: S2889)

10. Phenol/chloroform, pH 4.5–5.0 (Carl Roth, catalog number: X985.1)

11. Chloroform/isoamyl alcohol (Carl Roth, catalog number: X984.1)

12. 100% cold ethanol

13. 80% cold ethanol

14. 8 M urea (Sigma, catalog number: U5128)

15. 0.1% bromophenol blue (Sigma, catalog number: B0126)

16. 0.1% xylene cyanol (Sigma, catalog number: X4126)

17. 100 µM ddATP, ddGTP, ddCTP, and ddTTP (Roche, catalog number: 3732738001)

18. 3 M KOH (Sigma, catalog number: 221473)

19. 1 M tris-HCl, pH 8.0 (Sigma, catalog number: T1503)

20. 10% SDS (Bio-Rad, catalog number: 1610416)

21. Acetic acid (Sigma, catalog number: A6283)

22. 10× toeprinting buffer (see Recipes)

    
    

30S–mRNA complex preparation for cryo-EM

1. Liquid ethane

2. Liquid nitrogen

3. Quantifoil R2/2300-mesh holey carbon grids

   
   

Equipment

70S ribosome purification

1. 2 L flasks

2. Microbiological incubator (Thermo Scientific^TM, catalog number: 50125882 or equivalent)

3. Cell culture shaker at 30 °C

4. Class II biosafety cabinet

5. Floor centrifuges (Beckman, Avant J20 XP and/or Avanti J-E or equivalent)

6. JA-25.50 rotor (Beckman, catalog number: 363055)

7. JLA-16.250 rotor (Beckman, catalog number: 363930)

8. Ultracentrifuge (Beckman, OPTIMA XE90 or equivalent)

9. Type 45 Ti rotor (Beckman, catalog number: 339160)

10. SW28 rotor (Beckman, catalog number: 342204)

11. Gradient Master^TM base unit (Biocomp, catalog number: B108-2)

12. Gradient Master^TM device (BioComp Instruments, Fredericton, Canada)

13. Fraction collector (Bio-Rad, model: 2110)

14. NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA or equivalent)

    
    

30S subunit purification

1. Ultracentrifuge (Beckman, OPTIMA XE90 or equivalent)

2. SW41 Ti swinging-bucket rotor (Beckman, catalog number: 331362)

3. Floor centrifuges (Beckman, Avanti J-E or equivalent)

4. JLA-16.250 rotor (Beckman, catalog number: 363930)

   
   

mRNA purification

1. Cell culture shaker at 37 °C

2. Benchtop centrifuge (Eppendorf MiniSpin^® Plus personal microcentrifuge with 12-place rotor or equivalent)

3. Eppendorf thermomixer R, dry block heating and cooling shaker or equivalent

   
   

30S and mRNA quality analysis

1. Mini-PROTEAN^® Tetra Handcast systems (Bio-Rad or equivalent)

2. PowerPac^TM basic power supply (Bio-Rad or equivalent)

3. Wide mini-sub cell GT cell (Bio-Rad or equivalent)

4. GelDoc Go Gel imaging system (Bio-Rad)

   
   

Toeprinting assay

1. Benchtop centrifuge (Eppendorf MiniSpin^® Plus personal microcentrifuge with 12-place rotor or equivalent)

2. Phosphor imaging or autoradiography (Typhoon or equivalent)

   
   

30S–mRNA complex preparation cryo-EM data acquisition

1. Thermo Scientific Vitrobot Mark IV

2. Talos Arctica equipped with Falcon III direct electron detector (Thermo Fisher)

3. Microscope control PC with installed EPU software

Software

1. MotionCor2 (https://emcore.ucsf.edu/ucsf-software/)

2. Gctf (https://www2.mrc-lmb.cam.ac.uk/research/locally-developed-software/zhang-software/)

3. Relion 3.0 (https://www3.mrc-lmb.cam.ac.uk/relion/index.php/Main_Page/)

4. ResMap (http://resmap.sourceforge.net/)

5. Chimera (https://www.cgl.ucsf.edu/chimera/)

Procedure

1. 70S ribosome purification

   1. Streak Staphylococcus aureus’ RN6390 cells on a blood agar plate and grow at 37 °C for 20 h.

   2. Inoculate a single colony in 50 mL of sterile BHI medium in a 250 mL flask and grow for 17 h at 37 °C and 180 rpm.

   3. Add 5 mL of overnight culture to four 2 L flasks, each filled with 500 mL of sterile BHI medium, and grow for 3 h at 37 °C and 180 rpm until OD₆₀₀ = 1.

   4. Harvest cells by centrifugation at 4,400 × g for 15 min at 4 °C.

   5. Resuspend the pellet in 50 mL of buffer A.

   6. Collect the pellet by centrifugation at 4,400 × g for 15 min.

   7. Repeat the previous steps (5–6) two times.

   8. Weigh cells and keep at -80 °C.

      Note: The typical yield is 2.8 g of cells from 2 L of culture.

   9. Thaw the cells (2.8 g) on ice for 15–20 min and resuspend in 6.25 mL of buffer A supplemented with 0.7 mg lysostaphin, 1× protease inhibitor cocktail, 1 mM EDTA pH 7.5, and 6 µl DNase I per 1 gram of cell weight. Incubate for 1 h at 37 °C.

   10. Spin down the lysate at 21,500 × g (JA-25.50 rotor) for 90 min at 4 °C.

   11. Adjust the PEG20K concentration in the collected supernatant to 2.8% and leave the reaction on ice under agitation for 5 min.

   12. Collect the supernatant by centrifugation at 20,000 × g for 5 min (JA-25.50 rotor).

   13. Increase the PEG20K concentration to 4.2% and leave the reaction on ice under agitation for an additional 10 min.

   14. Collect the supernatant by centrifugation at 20,000 × g for 10 min (JA-25.50 rotor).

   15. Resuspend each pellet in 17.5 mL buffer A with 1 mM EDTA, lay on a 25 mL sucrose cushion (buffer B), and spin at 235,000 × g for 17 h at 4 °C (Type 45 Ti rotor).

   16. Rinse the walls of each tube with 5 mL of buffer E to remove excess sucrose and resuspend the pellet in 1 mL of buffer E.

   17. Lay the obtained sample on twelve 7%–30% sucrose gradients and spin at 83,000 × g for 16.5 h (SW28 rotor).

   18. Fractionate sucrose gradients (Figure 1A-I), pool fraction of 70S, and adjust the magnesium acetate to 25 mM and PEG20K to 4.5%. Leave on ice under agitation for 10 min.

   19. Pellet down the ribosomes by centrifugation at 20,000 × g for 13 min (JA-25.50 rotor) (Khusainov et al., 2016).

   20. Wash the tube walls with the dissociation buffer to remove the excess of sucrose and PEG. Resuspend the pellet in 1.5 mL of dissociation buffer.

       Note: The usual yield is 14 mg of 70S with at least 95% purity.

   21. Check the purity of 70S by 15% polyacrylamide gel (Figure 1A-II) and by mass-spectrometry analysis (Figure 1A-III).

       
       

2. 30S subunit purification

   1. Load 14 mg of 70S in the dissociation buffer directly on 0%–30% sucrose gradients equilibrated in the same buffer and spin at 109,000 × g for 14.5 h (SW28 rotor).

   2. Fractionate the sucrose gradients (Figure 1B-I) and adjust the magnesium acetate of pooled fractions to 10 mM and spermidine to 2.5 mM.

   3. Concentrate the 30S sample to 2–3 mg/mL in the Amicon ultra centrifugal filter.

      Note: By using two filters in parallel, it takes 1 h to concentrate the sample.

   4. Make aliquots, flash freeze them in liquid nitrogen, and store at -80 °C.

      Note: The volume of the aliquots should not be less than 3 μL to prevent evaporation of the sample. Moreover, the size of the aliquots should be small (3–5 μL), as a large amount of sample is not required for subsequent experiments.

      
      

   
   Figure 1. The 30S ribosomal subunits purification. The 30S (B) were obtained from 70S (A) by running through sucrose gradients twice (I and IV, 35 mL is the total volume of sucrose gradients). The bold blue line represents the fraction used for further experiments. Both 70S and 30S fractions were run on SDS-PAGE to check the purity of the samples (II and V). 70S ribosome was sent to mass spectrometry analysis to assess the sample purity (III). 16S was obtained from 30S by phenol/chloroform extraction and run on agarose gel in denaturing conditions to represent its integrity (VI).

   
   

3. spa mRNA purification

   The plasmid used in this study was previously described in Benito et al. (2000) and Huntzinger et al. (2005). The pUT7 plasmid contains a T7 promoter for T7 in vitro transcription and ampicillin resistance. spa mRNA sequence with a strong Shine–Dalgarno AGGGGG (underlined) and UUG start codon (bold) is shown below:

   ACAAAUACAUACAGGGGGUAUUAAUUUGAAAAAGAAAAACAUUUAUUCAAUUCGUAAACUAGGUGUAGGUAUUGCAUCUGUAACUUUAGGUACAUUACUUAUAUCUGGUGGCGUAACACCUGCUGCAAAUGCUGCGCAACACGAUGAAGCUCAACAAAAUGCUUUUUAUCAAGUCUUAAAUAUGCCUAACUUAAACGCUGGGAUCCUCUAGAGUCGACCUGCAGG

   
   

   Note: Before starting to work with the mRNA, wipe the bench and pipettes with a liquid that removes RNase contamination (e.g., RNaseZap).

   1. Transform XL1 Escherichia coli cells with the pUT7-spa plasmid.

   2. Grow cells in 250 mL of LB medium with 100 μg/mL ampicillin at 37 °C for 16 h.

   3. Purify the plasmid using a NucleoSpin Plasmid mini kit and linearize it (up to 50 μg of plasmid per reaction) with BamHI enzyme in a 1× CutSmart buffer for 2 h at 37 °C.

      Note: The usual yield is 10 μg of plasmid per one reaction. One linearization reaction is enough to proceed with the experiments.

   4. Extract the linearized plasmid DNA from 1% agarose gel using a NucleoSpin Gel and PCR Clean-up mini kit.

   5. Extract the DNA with phenol/chloroform:

      1. Add an equal volume of phenol, vortex well, and spin down at 17,000 × g for 1 min. Keep the upper phase.

      2. Add an equal volume of chloroform, vortex well, and spin down at 17,000 × g for 1 min. Keep the upper phase.

   6. Precipitate the DNA with 2.5 volumes of 100% cold ethanol and 1/16 volume of 3 M sodium acetate.

   7. Wash the pellet with 500 μL of 80% cold ethanol.

   8. In vitro transcribe the mRNA for 3 h at 37 °C using a MEGAscript kit.

   9. Stop the reaction with 2 U/μL DNase turbo and incubate for 15 min at 37 °C.

   10. Extract the mRNA with phenol/chloroform and precipitate it with 100% cold ethanol (similar to steps 5 and 6).

   11. Wash the pellet with 500 μL of 80% cold ethanol.

   12. Add 50% formamide to the sample and heat for 3 min at 90 °C.

   13. Separate the mRNA by 6% polyacrylamide midi-size gel and elute with the buffer ELU for 16 h at 4 °C.

   14. Extract the mRNA with phenol/chloroform and precipitate it with 100% cold ethanol (similar to steps 5 and 6).

   15. Wash the pellet with 200 μL of 80% cold ethanol.

   16. Resuspend in 10–30 μL mQ water.

   17. Store the aliquots at -20 °C.

       
       

5. 30S and mRNA quality analysis

   The absence of high-molecular-weight non-ribosomal proteins and the presence of all ribosomal proteins are detected on a 15% polyacrylamide gel (Figure 1B-V). The positions of all 70S ribosomal proteins on the SDS-PAGE are identified in Khusainov et al. (2016) (Figure 1A-II). The ribosomal RNA integrity is checked by 0.8% agarose gel in denaturing conditions (Figure 1B-VI).

   1. Protein polyacrylamide gel

      1. Mix all buffer components for the 15% resolving gel and leave to polymerase for 15–20 min.

      2. Repeat the same procedure for 4% stacking gel.

      3. Add 1× blue buffer to the 30S samples (0.15 OD per lane) and heat for 3 min at 95 °C.

      4. Load 5 μL of protein ladder and 5 μL of 30S samples in the blue buffer.

      5. Run the gel in a 1× running buffer at 120 V for 30 min and then at 150 V for 1 h.

      6. Stain the gel in InstantBlue^® coomassie for 20 min and destain in water for 1 h.

   2. Extracting the ribosomal RNA

      1. Add an equal volume of phenol to the 0.15 OD 30S, mix well by vortexing, and spin down at 17,000 × g for 1 min.

      2. Add an equal volume of chloroform to the upper phase, mix well by vortexing, and spin down at 17,000 × g for 1 min.

      3. Repeat the two last steps.

      4. Precipitate the ribosomal RNA with 1/10 volume 3 M sodium acetate pH 5.3 and 2.5 volumes of 100% cold ethanol.

      5. Keep the sample overnight at -20 °C or for 1 h at -80 °C and spin down at 17,000 × g for 15 min at 4 °C.

      6. Wash the pellet with 70% cold ethanol and dry it for 5 min in a speed vac.

      7. Resuspend the obtained sample in 10 μL of mQ water.

   3. RNA agarose gel

      1. Melt 0.8% agarose in 1× TBE buffer in the microwave and then cool down to 60 °C.

      2. Add 100 mM potassium thiocyanate and ethidium bromide to the mixture.

      3. Leave the gel for 40 min to polymerase.

      4. Load 0.015 OD of the sample on the gel together with a high-range RNA ladder.

      5. Run the gel in a 1× TBE buffer at 120 V for 45 min.

   4. RNA polyacrylamide gel

      The mRNA purity and integrity are checked by 6% polyacrylamide gel stained in ethidium bromide (Figure 2C). The sequence of spa mRNA is shown in Figure 2D.

      1. Mix all components for 6% polyacrylamide gel and leave to polymerize for 15–20 min.

      2. Load 4 μL of low-range RNA ladder in 1× RNA loading dye close to the 100 ng of mRNA in 50% formamide preheated at 90 °C for 2 min.

      3. Run the gel at 200 V for 30 min.

      4. Stain the gel in ethidium bromide for 10 min.

         
         

6. Toeprinting assay

   1. Mix 1 μM Toe primer in PNK buffer, 10 U/μL T4 PNK, and 5 μL of [γ-³²P]-ATP, incubate at 37 °C for 1 h, and then pass through the micro bio-spin column pre-equilibrated in mQ water.

   2. Incubate 0.5 μM of spa mRNA with 169,916 cpm/μL Toe primer in a toeprinting buffer at 90 °C for 1 min, put on ice for 1 min, and then add MgCl₂ to a 10 mM final concentration. Leave for refolding/annealing at 20 °C for 15 min. The final volume of the reaction mixture is 20 μL.

   3. Mix 33,983 cpm/μL of mRNA-Toe primer with 0.025 μM, 0.05 μM, and 0.2 μM 30S small ribosomal subunits. Incubate at 37 °C for 10 min and with 0.1 μM itRNA for an additional 5 min (final MgCl₂ concentration should be 8 mM). The final volume of the reaction mixture is 13 μL.

   4. Incubate obtained samples with 0.3 U/μL of AMV reverse transcriptase and 0.3 mM dNTPs in AMV buffer for 30 min at 37 °C, extract with phenol/chloroform, and resuspend in urea blue buffer.

   5. For sequencing lanes, incubate 0.33 μM mRNA with 135,932 cpm/μL Toe primer, 1.7 μM nucleotides, and 0.27 U/μL AMV reverse transcriptase in AMV buffer at 37 °C for 30 min.

   6. Add 237 mM KOH, 26 mM tris-HCl pH 8, 0.26 % SDS, and 3.9 mM EDTA to the samples for the sequencing lanes and incubate at 90 °C for 3 min and at 37 °C for 1 h. Precipitate RNA in 0.3 M sodium acetate and 100% cold ethanol and resuspend in urea blue buffer.

   7. Migrate both samples on a 10%, 40 cm, 0.5 mm denaturing polyacrylamide gel.

   8. Obtain the data by autoradiography (Figure 2A and 2B).

      
      

   
   Figure 2. Toeprinting assay of the 30S–mRNA–itRNA complex. (A) Scheme of the toeprinting assay. (B) Toeprint analysis of the 30S–mRNA–itRNA complex formation with increasing 30S concentration. (C) The intactness of mRNA was checked by polyacrylamide gel in denaturing conditions. (D) Sequence of spa mRNA with the start codon in bold and Shine–Dalgarno sequence underlined; the +16 nucleotide is shown by the black arrow.

   
   

6. 30S–mRNA complex preparation for cryo-EM

   1. Combine 450 nM of spa mRNA with 90 nM of 30S in a storage buffer, apply immediately on the Quantifoil R2/2300-mesh holey carbon cryo-EM grids, and plunge-freeze in liquid ethane using a Vitrobot Mark IV device (4 °C and 100% humidity) under the following conditions: 4 μL of complex on the grid, 3 s blotting time, blot force of 5, and waiting time of 30 s.

   2. Clip the grids into the cartridges if you intend to use an Autoloader equipped microscope.

   3. Keep in liquid nitrogen until data acquisition.

      
      

7. Data acquisition and analysis

   1. Collect the data on a 200 kV Talos Arctica instrument with a Falcon III direct electron detector under the focus range of -0.5 to -2.7 μm with a 0.2 step.

      Note: For our purposes, the 120,000× magnification was used, yielding a pixel size of 1.24 Å.

   2. Transfer the obtained data to the workstation or cluster for data processing.

   3. Use the RELION 3.0 software for data processing (Zivanov et al., 2018).

   4. Perform drift and gain correction and dose weighting with MotionCor2 (Zheng et al., 2017).

   5. Use a dose-weighted average image of the whole stack to determine the contrast transfer function with the software Gctf (Zhang et al., 2016).

   6. Pick the particles using a Laplacian of Gaussian function (min diameter 180 Å, max diameter 290 Å).

   7. Extract the particles with a box size of 270 pixels and divide into several classes for 3D classification.

   8. Merge classes (if necessary), extract the original size, and continue with 3D refinement.

      The obtained 30S–mRNA structure has been refined to an overall 3.6 Å resolution with individual focused refinement of the head and the body leading to the resolution of 3.6 and 3.4 Å, respectively (Figure 3B and 3C).

   9. Estimate the local resolution in RELION 3.0 (Zivanov et al., 2018).

   10. Analyze structures in Chimera (Pettersen et al., 2004) or ChimeraX (Goddard et al., 2018) (Figure 3A).

       
       

   
   Figure 3. Scheme of the cryo-EM data processing. Electron movies were obtained from sample collection on the Talos microscope. After motion correction and contrast transfer function (CTF) estimation, the particles were picked and extracted with a minimum diameter of 180 Å and maximum diameter of 290 Å. The next steps were 2D and 3D classification, followed by 3D refinement and post-processing. The final 30S–mRNA structure was obtained at 3.6 Å with focus refinement on the head and body at 3.4 and 3.6 Å, respectively.

Recipes

70S ribosome purification

1. Buffer A
   100 mM NH₄Cl
   21 mM Mg acetate
   20 mM HEPES-KOH, pH 7.5
   1 mM dithiothreitol (DTT)

2. Buffer B
   1.05 M sucrose
   0.5 M KCl
   10.5 mM Mg acetate
   0.5 mM EDTA
   20 mM HEPES-KOH, pH 7.5
   1 mM DTT
3. 5× buffer E
   500 mM KCl
   50 mM Mg acetate
   2.5 mM EDTA
   50 mM HEPES-KOH, pH 7.5
   5 mM DTT
4. Dissociation buffer
   1 mM Mg acetate
   30 mM NH₄Cl
   10 mM HEPES-KOH, pH 7.5
   1 mM DTT
   
   

1. 30S subunit purification

1. 30S storage buffer

   10 mM Mg acetate

   30 mM NH₄Cl

   10 mM HEPES-KOH, pH 7.5

   1 mM DTT

   2.5 mM spermidine

   
   

mRNA purification

1. Buffer ELU

   16% (v/v) phenol pH 4.5–5.0

   50 mM ammonium acetate

   1 mM EDTA, pH 8.0

   
   

30S and mRNA quality analysis

1. 4% stacking gel

   4% (v/v) ROTIPHORESE^® NF-acrylamide/bis-solution 30 (37.5:1)

   125 mM tris-HCl, pH 6.8

   0.1% (w/v) sodium dodecyl sulfate

   0.1% (v/v) ammonium persulfate

   1/500 V TEMED

2. 15% resolving gel

   15% (v/v) ROTIPHORESE^® NF-acrylamide/bis-solution 30 (37.5:1)

   375 mM tris-HCl, pH 8.8

   0.1% (w/v) sodium dodecyl sulfate

   0.1% (v/v) ammonium persulfate

   1/1000 V TEMED

3. 4× blue buffer

   0.25 M tris-HCl, pH 6.8

   9.2% (w/v) sodium dodecyl sulfate

   40% (v/v) glycerol

   0.1% (w/v) bromophenol blue

   100 mM DTT

4. 10× running buffer

   30 g tris base

   144 g glycine

   10 g sodium dodecyl sulfate in 1,000 mL of mQ water, pH 8.3

5. 6% polyacrylamide gel

   6% (v/v) ROTIPHORESE^® NF-acrylamide/bis-solution 40 (19:1)

   1× TBE

   8 M urea

6. 10× TBE

   108 g tris base

   55 g boric acid

   40 mL 0.5 M EDTA, pH 8.0 in 1,000 mL of mQ water, pH 8.3

7. 1× TBE is a 1:10 dilution of the 10× TBE (from step 6)

   
   

Toeprinting assay

1. 10× toeprinting buffer

   100 mM tris-HCl, pH 7.5

   300 mM KCl

   5 mM DTT

2. 10% polyacrylamide gel

   10% (v/v) acrylamide/bis-solution 40 (19:1)

   1× TBE

   8 M urea

3. Urea blue buffer

   0.025% bromophenol blue

   xylene cyanol in 7.6 M urea

Acknowledgments

This work, of the Interdisciplinary Thematic Institute IMCBio+, as part of the ITI 2021-2028 program of the University of Strasbourg, CNRS, and Inserm, was supported by the CNRS, by the Agence Nationale de la Recherche (ANR, grant ANR-21-CE12-0030-01 (SM), IdEx Unistra (ANR-10-IDEX-0002), SFRI-STRAT’US project (ANR 20-SFRI-0012) and EUR IMCBio (ANR-17-EURE-0023) under the framework of the French Investments for the Future Program. We thank Dr. Marat Yusupov, Dr. Yaser Hashem, Dr. Pascale Romby, and Dr. Angelita Simonetti for useful discussions and critical advice, and Dr. Yaser Hashem and Dr. Armel Bézault for help in Data acquisition on the Talos Arctica microscope.

This protocol was adapted from Belinite et al. (2021).

Competing interests

The authors declare no competing interests.

References

1. Agirrezabala, X., Lei, J., Brunelle, J. L., Ortiz-Meoz, R. F., Green, R. and Frank, J. (2008). Visualization of the hybrid state of tRNA binding promoted by spontaneous ratcheting of the ribosome. Mol Cell 32(2): 190-197.
2. Akanuma, G. (2021). Diverse relationships between metal ions and the ribosome. Biosci Biotechnol Biochem 85(7): 1582-1593.
3. Bartetzko, A. and Nierhaus, K. H. (1988). Mg²⁺/NH₄⁺/polyamine system for polyuridine-dependent polyphenylalanine synthesis with near in vivo characteristics. Methods Enzymol 164: 650-658.
4. Belinite, M., Simonetti, A., Marzi, S., Khusainov, I., Romby, P., Yusupov, M. and Hashem, Y. (2018). Initiation translation complex of Staphylococcus aureus ribosome. FEBS OpenBio 8: 433.
5. Belinite, M., Khusainov, I., Soufari, H., Marzi, S., Romby, P., Yusupov, M. and Hashem, Y. (2021). Stabilization of Ribosomal RNA of the Small Subunit by Spermidine in Staphylococcus aureus. Front Mol Biosci 8.
6. Benito, Y., Kolb, F. A., Romby, P., Lina, G., Etienne, J. and Vandenesch, F. (2000). Probing the structure of RNAIII, the Staphylococcus aureus agr regulatory RNA, and identification of the RNA domain involved in repression of protein A expression. RNA 6(5): 668-679.
7. Cohen, S. S. (1971). Introduction to the Polyamines. Englewood cliffs, New Jersey: Prentice-Hall.
8. Cohen, S. S. and Lichtenstein, J. (1960). Polyamines and ribosome structure. J Biol Chem 235: 2112-2116.
9. Cressey, D. and Callaway, E. (2017). Cryo-electron microscopy wins chemistry Nobel. Nature 550(7675): 167.
10. Echandi, G. and Algranati, I. D. (1975). Defective 30S ribosomal particles in a polyamine auxotroph of Escherichia coli. Biochem Biophys Res Commun 67(3): 1185-1191.
11. Fahnestock, S. R. (1977). Reconstitution of active 50 S ribosomal subunits from Bacillus licheniformis and Bacillus subtilis. Arch Biochem Biophys 182(2): 497-505.
12. Fechter, P., Chevalier, C., Yusupova, G., Yusupov, M., Romby, P. and Marzi, S. (2009). Ribosomal initiation complexes probed by toeprinting and effect of trans-acting translational regulators in bacteria. Methods Mol Biol 540: 247-263.
13. Frank, J., Gao, H., Sengupta, J., Gao, N. and Taylor, D. J. (2007). The process of mRNA-tRNA translocation. Proc Natl Acad Sci U S A 104(50): 19671-19678.
14. Goddard, T. D., Huang, C. C., Meng, E. C., Pettersen, E. F., Couch, G. S., Morris, J. H. and Ferrin, T. E. (2018). UCSF ChimeraX: Meeting modern challenges in visualization and analysis. Protein Sci 27(1): 14-25.
15. Gordon, J. and Lipmann, F. (1967). Role of divalent ions in poly U-directed phenylalanine polymerization. Journal of Molecular Biology 23(1): 23-33.
16. Hamana, K. and Satake, S. (1995). ABSENCE OF CELLULAR POLYAMINES IN GRAM-POSITIVE ANAEROBIC COCCI AND LACTIC ACID BACTERIA. J Gen Appl Microbiol 41(2): 159-163.
17. Hardy, S. J. and Turnock, G. (1971). Stabilization of 70S ribosomes by spermidine. Nat New Biol 229(1): 17-19.
18. Herbst, E. J., Weaver, R. H. and Keister, D. L. (1958). The gram reaction and cell composition: Diamines and polyamines. Arch Biochem Biophys 75(1): 171-177.
19. Hershko, A., Amoz, S. and Mager, J. (1961). Effect of polyamines and divalent metals on in vitro incorporation of amino acids into ribonucleoprotein particles. Biochem Biophys Res Commun 5: 46-51.
20. Hetrick, B., Khade, P. K., Lee, K., Stephen, J., Thomas, A. and Joseph, S. (2010). Polyamines accelerate codon recognition by transfer RNAs on the ribosome. Biochemistry 49(33): 7179-7189.
21. Huntzinger, E., Boisset, S., Saveanu, C., Benito, Y., Geissmann, T., Namane, A., Lina, G., Etienne, J., Ehresmann, B., Ehresmann, C., et al. (2005). Staphylococcus aureus RNAIII and the endoribonuclease III coordinately regulate spa gene expression. The EMBO Journal 24(4): 824-835.
22. Hussain, T., Llácer, J. L., Wimberly, B. T., Kieft, J. S. and Ramakrishnan, V. (2016). Large-Scale Movements of IF3 and tRNA during Bacterial Translation Initiation. Cell 167(1): 133-144.e113.
23. Igarashi, K., Hikami, K., Sugawara, K. and Hirose, S. (1973). Effect of polyamines on polypeptide synthesis in rat liver cell-free system. Biochim Biophys Acta 299(2): 325-330.
24. Igarashi, K. and Kashiwagi, K. (2018). Effects of polyamines on protein synthesis and growth of Escherichia coli. J Biol Chem 293(48): 18702-18709.
25. Igarashi, K., Kishida, K. and Hirose, S. (1980). Stimulation by polyamines of enzymatic methylation of two adjacent adenines near the 3' and end of 16S ribosomal RNA of Escherichia coli. Biochem Biophys Res Commun 96(2): 678-684.
26. Jahagirdar, D., Jha, V., Basu, K., Gomez-Blanco, J., Vargas, J. and Ortega, J. (2020). Alternative conformations and motions adopted by 30S ribosomal subunits visualized by cryo-electron microscopy. RNA 26(12): 2017-2030.
27. Khusainov, I., Vicens, Q., Bochler, A., Grosse, F., Myasnikov, A., Ménétret, J. F., Chicher, J., Marzi, S., Romby, P., Yusupova, G., et al. (2016). Structure of the 70S ribosome from human pathogen Staphylococcus aureus. Nucleic Acids Res 44(21): 10491-10504.
28. Kim, H. D., Puglisi, J. D. and Chu, S. (2007). Fluctuations of Transfer RNAs between Classical and Hybrid States. Biophys J 93(10): 3575-3582.
29. Konecki, D., Kramer, G., Pinphanichakarn, P. and Hardesty, B. (1975). Polyamines are necessary for maximum in vitro synthesis of globin peptides and play a role in chain initiation. Arch Biochem Biophys 169(1): 192-198.
30. Martin, R. G. and Ames, B. N. (1962). THE EFFECT OF POLYAMINES AND OF POLY U SIZE ON PHENYLALANINE INCORPORATION. Proc Natl Acad Sci U S A 48(12): 2171-2178.
31. McMurry, L. M. and Aglranati, I. D. (1986). Effect of polyamines on translation fidelity in vivo. Eur J Biochem 155(2): 383-390.
32. Nakane, T., Kotecha, A., Sente, A., McMullan, G., Masiulis, S., Brown, P. M. G. E., Grigoras, I. T., Malinauskaite, L., Malinauskas, T., Miehling, J., et al. (2020). Single-particle cryo-EM at atomic resolution. Nature 587(7832): 152-156.
33. Nierhaus, K. H. (2014). Mg²⁺, K⁺, and the ribosome. J Bacteriol 196(22): 3817-3819.
34. Pettersen, E. F., Goddard, T. D., Huang, C. C., Couch, G. S., Greenblatt, D. M., Meng, E. C. and Ferrin, T. E. (2004). UCSF Chimera--a visualization system for exploratory research and analysis. J Comput Chem 25(13): 1605-1612.
35. Rheinberger, H.-J. and Nierhaus, K. H. (1987). The Ribosomal E Site at Low Mg²⁺: Coordinate Inactivation of Ribosomal Functions at Mg²⁺ Concentrations Below 10 mM and its Prevention by Polyamines. J Biomol Struct Dyn 5(2): 435-446.
36. Rosenthal, S. M. and Dubin, D. T. (1962). Metabolism of polyamines by Staphylococcus. J Bacteriol 84(4): 859-863.
37. Rozov, A., Khusainov, I., El Omari, K., Duman, R., Mykhaylyk, V., Yusupov, M., Westhof, E., Wagner, A. and Yusupova, G. (2019). Importance of potassium ions for ribosome structure and function revealed by long-wavelength X-ray diffraction. Nat Commun 10(1): 2519.
38. Stahli, C. and Noll, H. (1977). Structural dynamics of bacterial ribosomes. Molecular and General Genetics MGG 153(2): 159-168.
39. Stevens, L. (1969). The binding of spermine to the ribosomes and ribosomal ribonucleic acid from Bacillus stearothermophilus. Biochem J 113(1): 117-121.
40. Takeda, Y. (1969). Polyamines and protein synthesis. I. The effect of polyamines on cell free polyphenylalanine synthesis in Escherichia coli. J Biochem 66(3): 345-349.
41. Turnock, G. and Birch, B. (1973). Binding of putrescine and spermidine to ribosomes from Escherichia coli. Eur J Biochem 33(3): 467-474.
42. Weiss, R. L., Kimes, B. W. and Morris, D. R. (1973). Cations and ribosome structure. 3. Effects on the 30S and 50S subunits of replacing bound Mg²⁺ by inorganic cations. Biochemistry 12(3): 450-456.
43. Weiss, R. L. and Morris, D. R. (1970). The inality of polyamines to maintain ribosome structure and function. Biochim Biophys Acta 204(2): 502-511.
44. Wohlgemuth, I., Pohl, C. and Rodnina, M. V. (2010). Optimization of speed and accuracy of decoding in translation. Embo j 29(21): 3701-3709.
45. Zhang, K. (2016). Gctf: Real-time CTF determination and correction. J Struct Biol 193(1): 1-12.
46. Zhang, W., Dunkle, J. A. and Cate, J. H. (2009). Structures of the ribosome in intermediate states of ratcheting. Science 325(5943): 1014-1017.
47. Zheng, S. Q., Palovcak, E., Armache, J.-P., Verba, K. A., Cheng, Y. and Agard, D. A. (2017). MotionCor2: anisotropic correction of beam-induced motion for improved cryo-electron microscopy. Nature Methods 14(4): 331-332.
48. Zivanov, J., Nakane, T., Forsberg, B. O., Kimanius, D., Hagen, W. J., Lindahl, E. and Scheres, S. H. (2018). New tools for automated high-resolution cryo-EM structure determination in RELION-3. Elife 7: e42166.