A Ribosome Footprinting Protocol for Plants

Materials and Reagents

1. Materials
   1. Miracloth
      
   2. 30 ml Nalgene^TM High-Speed polycarbonate centrifuge tubes (Thermo Fisher Scientific, Thermo Scientific^TM, catalog number: 3118-0030 ) (or equivalent) to centrifuge the plant extracts
      
   3. 5 ml polypropylene thin-wall ultracentrifuge tubes (Beckman Coulter, catalog number: 326819 )
      
   4. 10 ml ultracentrifuge 14 x 89 mm tubes with isopycnic caps (BioComp Instruments, catalog number: 105-914A )
      
   5. Fine scale
      
   6. 10 ml syringe
      
   7. Cannula to be attached to the syringe (Thomas Scientific, catalog number: 1193G13 )
      
   8. Pre-sterilized, RNase-free 5 ml, 1 ml, 200 µl and 10 µl micropipette tips
      
   9. Pre-sterilized, RNase-free 2 ml and 1.5 ml microcentrifuge tubes
      
   10. 15 and 50 ml Falcon tubes
       
   11. Stoppers to secure the lids of 1.5 ml tubes
       
   12. Razor blades
       
   13. Dynabeads mRNA Purification Kit (Thermo Fisher Scientific, Ambion^TM, catalog number: 610-06 )
       
   14. 2 ml microcentrifuge tubes
       
   15. 1.5 ml non-stick, RNase-free microtubes (Thermo Fisher Scientific, Applied Biosystems^TM, catalog number: AM12450 )
       
   16. MyOne^TM Streptavidin C1 DynaBeads^® (Thermo Fisher Scientific, Invitrogen^TM, catalog number: 65601 )
       
   17. 200 μl PCR strip tubes
       
       
2. Reagents
   
   1. Liquid nitrogen
      
   2. RNase-free, sterile, MilliQ water
      
   3. Tris base
      
   4. Sucrose
      
   5. Potassium chloride (KCl)
      
   6. Sodium chloride (NaCl)
      
   7. Magnesium chloride (MgCl₂)
      
   8. Ethyleneglycol-bis(2-aminoethylether)-N,N,N’,N-tetraacetic acid (EGTA)
      
   9. Ethylene diamintetracetic acid (EDTA)
      
   10. Dithiothreitol (DTT)
       
   11. Brij-35 [Polyoxyethylene(23)lauryl ether]
       
   12. Triton X-100
       
   13. Igepal CA 630 (Octylphenyl-polyethylene glycol)
       
   14. Tween 20 (Polyoxyethylene sorbitan monolaurate 20)
       
   15. Cycloheximide (see Note 1)
       
   16. Chloramphenicol (see Note 1)
       
   17. Lithium chloride (LiCl)
       
   18. Sodium acetate (NaOAc)
       
   19. Sodium bicarbonate (NaHCO₃)
       
   20. Sodium carbonate (Na₂CO₃)
       
   21. Sodium dodecyl sulfate (SDS)
       
   22. Sodium hydroxide (NaOH)
       
   23. Trisodium citrate (Na₃C₆H₅O₇)
       
   24. Dimethylsulfoxide (DMSO), PCR grade
       
   25. Ethanol, molecular biology grade
       
   26. Water-saturated, acid phenol, molecular biology grade (see Note 2)
       
   27. Chloroform, molecular biology grade (see Note 2)
       
   28. Isoamyalcohol
       
   29. Isopropanol, molecular biology grade
       
   30. PEG8000
       
   31. 15 mg/ml GlycoBlue^TM (Thermo Fisher Scientific, Invitrogen^TM, catalog number: AM9515 )
       
   32. 10 bp DNA ladder (Thermo Fisher Scientific, Invitrogen^TM, catalog number: 10821015 )
       
   33. 2x denaturing sample buffer with dye (Thermo Fisher Scientific, Invitrogen^TM, catalog number: LC6876 ) (see Note 3)
       
   34. SYBR^® Gold, 10,000x in DMSO (Thermo Fisher Scientific, Invitrogen^TM, catalog number: S11494 ) (see Note 4)
       
   35. dNTP mix, 10 mM (Thermo Fisher Scientific, Invitrogen^TM, catalog number: 18427-013 )
       
   36. OmniPur^® polyethylene glycol 8000 (EMD Millipore, Calbiochem^®, catalog number: 6510 )
       
   37. Universal miRNA cloning linker (New England Biolabs, catalog number: S1315S )
       
   38. Boric acid
       
   39. Acetic acid
       
   40. 12-well 15% polyacrylamide TBE-Urea gels (Bio-Rad Laboratories, catalog number: 4566055 ) (see Note 5)
       
   41. 30% acrylamide/bisacrylamide (29:1) (Bio-Rad Laboratories, catalog number: 161-0156 ) (see Note 5)
       
   42. Ammonium persulfate (APS)
       
   43. TEMED (N,N,N’,N’-Tetramethylethane-1,2-diamine) (Sigma-Aldrich, catalog number: T7024 )
       
   44. Glycerol
       
   45. Bromophenol blue
       
       
3. Enzymes
   
   1. SUPERase-In^TM RNase inhibitor (Thermo Fisher Scientific, Ambion^TM, catalog number: AM2694 )
      
   2. TURBO^TM DNase (2 U/μl) (Thermo Fisher Scientific, Ambion^TM, catalog number: AM2238 )
      
   3. RNase I (100 U/μl) (Thermo Fisher Scientific, Invitrogen^TM, catalog number: AM2294 )
      
   4. SuperScript^® III reverse transcriptase (Thermo Fisher Scientific, Invitrogen^TM, catalog number: 18080-093 )
      
   5. T4 polynucleotide kinase, T4 PNK4 (New England Biolabs, catalog number: M0201 ), supplied with 10x T4 PNK buffer (New England Biolabs, catalog number: B0201 ) (see Note 6)
      
   6. T4 RNA ligase 2, truncated (New England Biolabs, catalog number: M0242 ), supplied with PEG 8000 50% and 10x T4 Rnl2 buffer
      
   7. Phusion high-fidelity DNA polymerase (2 U/μl) (Thermo Fisher Scientific, Thermo Scientific^TM, catalog number: F-530S )
      
   8. CircLigase^TM ssDNA ligase (100 U/μl) (Epicentre, catalog number: CL4115K )
      
      
4. Oligonucleotides
   
   1. Reverse transcription primer for split-adapter circularization (see Note 7)
      NI-NI-9: [P]AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC[SC18]CACTCA[SC18]TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG (Ingolia et al., 2009)
      
   2. Size marker oligos (Ingolia et al., 2009) (see Note 8)
      oNTI265: rArUrGrUrArCrArCrGrGrArGrUrCrGrArGrCrUrCrArArCrCrCrGrCrArArCrGrCrGrA
      oNTI268: rArUrGrUrArCrArCrGrGrArGrArCrCrCrGrCrArArCrGrCrGrA
      
   3. rRNA subtraction oligos (all the oligos here have a 5’ TEG-linked biotin and were obtained from IDT),These oligos are based on the most abundant rRNA sequences and transposons that were found using 3-day-old Arabidopsis seedlings and the ribosome footprinting protocol described herein (see Note 9)
      rRNABio1: 5’-gataaccgtagtaattctagag-3’
      rRNABio2&4: 5’-TGATTCATGATAACTCGACGGACGACGCGGATTACGGTGGCGGC-3’
      rRNABio5&3: 5’-GTCGCTGCCGTGATCGTGGTCTCCATCGAGTCTTTGAACGCAAG-3’
      Bio-Tranpos: 5’-GAGGGATGCAACACGAGGAGTTCCCGGGAGGTCA-3’
      Bio-5S: 5’-AAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGTGTCACAA-3’
      Bio-18S: 5’-AAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTG-3’
      
   4. Amplification primers
      NI-NI-2: 5’-AATGATACGGCGACCACCGAGATCTACAC-3’ (Ingolia et al., 2009)
      NI-NI-3: 5’-CAAGCAGAAGACGGCATACGAGATAGTCGTGTGACTGGAGTTCAGACGTGTGCTCTTCCG-3’ (Ingolia et al., 2009)
      Alternative indexed primers
      Index 1:
      5’-CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGCTCTTCCG-3’
      Index 2:
      5’-CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTCAGACGTGTGCTCTTCCG-3’
      Index 3:
      5’-CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCAGACGTGTGCTCTTCCG-3’
      Index 4:
      5’-CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTCAGACGTGTGCTCTTCCG-3’
      Index 5:
      5’-CAAGCAGAAGACGGCATACGAGATCACTGTGTGACTGGAGTTCAGACGTGTGCTCTTCCG-3’
      Index 6:
      5’-CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTCAGACGTGTGCTCTTCCG-3’
      Index 7:
      5’-CAAGCAGAAGACGGCATACGAGATGATCTGGTGACTGGAGTTCAGACGTGTGCTCTTCCG-3’
      
      
5. Solutions
   All solutions should be prepared with RNase-free, MilliQ water. Unless otherwise stated, all of them must be sterilized by autoclaving for at least 20 min and stored at room temperature.
   
   1. 1 M Tris-HCl, pH 7.0 (see Note 10)
      
   2. 1 M Tris-HCl, pH 8.0 (see Note 10)
      
   3. 1 M Tris-HCl, pH 9.0 (see Note 10)
      
   4. 1 M sucrose, prepared from Molecular Biology grade sucrose (autoclave for 10 min)
      
   5. 1 M KCl
      
   6. 5 M NaCl
      
   7. 1 M MgCl₂
      
   8. 0.5 M EGTA, pH 8.0 (see Note 11)
      
   9. 0.5 M EDTA, pH 8.0 (see Note 11)
      
   10. 2 mM EDTA, 100 mM Na₂CO₃
       
   11. 2 mM EDTA, 100 mM NaHCO₃
       
   12. 3 M NaOAc, pH 5.5
       
   13. 10% SDS (w/v)
       
   14. 1 M NaOH (no sterilization required)
       
   15. 4 M LiCl (filter-sterilize, do not autoclave)
       
   16. 1 M DTT (do not autoclave; aliquot and store at -20 °C)
       
   17. 100 mg/ml cycloheximide, prepared in DMSO (filter-sterilize; aliquot and store at -20 °C)
       
   18. 50 mg/ml chloramphenicol, prepared in ethanol (filter-sterilize; aliquot and store at -20 °C)
       
   19. Detergent mix 20% (w/v or v/v) of each of four detergents in water (Brij-35, Triton X-100, Igepal CA 630 and Tween 20)
       
   20. 50% PEG8000 (w/v), prepared by combining dry PEG with water in a 50 ml conical and mixing with gentle shaking overnight. No sterilization is required. PEG is very hygroscopic; so start adding PEG to less than half of the final volume of MilliQ water. Then, after it is dissolved, add more water if needed. PEG used for ligation (step C3) should not be more than 1 month old.
       
   21. 10% APS (w/v), Filter-sterilize and aliquot in small volumes (e.g., 500 µl). Store at -20 °C. Aliquots can be thawed and re-frozen several times.
       
       
6. Buffers (see Recipes)
   
   1. Polysome extraction buffer (PEB)
      
   2. Sucrose cushion A (SCA)
      
   3. Sucrose gradients solutions
      
   4. Polysome digestion buffer (PDB)
      
   5. Sucrose cushion B (SCB)
      
   6. Polysome resuspension buffer (PRB)
      
   7. Total RNA extraction buffer (TREB)
      
   8. Alkaline fragmentation buffer (2x)
      
   9. Alkaline fragmentation stop/precipitation solution
      
   10. TAE (Tris/acetate/EDTA buffer) (50x)
       
   11. TBE (Tris/borate/EDTA buffer) buffer (5x)
       
   12. RNA gel extraction buffer (GEB)
       
   13. DNA gel extraction buffer (STE)
       
   14. SSC (20x)
       
   15. Subtraction bind/wash buffer (2x)
       
   16. 8% non-denaturing polyacrylamide gel (12 ml)
       
   17. Non-denaturing loading dye (6x)
       

Equipment

1. 7-9 cm diameter porcelain mortar and pestle
   
2. Small (30-50 ml) glass beakers
   
3. Refrigerated Beckman Avanti J-25 centrifuge and Beckman JA17 rotor (or equivalent)
   
4. Ultracentrifuge Beckman L8-70M (or equivalent) with swinging bucket rotors for polysome pelleting (Beckman Coulter, model: SW55Ti ) and sucrose gradient centrifugation (Beckman Coulter, model: SW41Ti or Thermo Fisher Scientific, Thermo Scientific^TM, model: TH-641 ).
   
5. Automatic P1000, P200 and P10 micropipettes
   
6. Refrigerated tabletop microcentrifuge
   
7. Orbital shaker
   
8. Gradient Master Station, with both the gradient maker and the fractionation station (BioComp Instruments)
   
9. Continuous UV light monitor (Bio-Rad Laboratories, model: EM-1 Econo UV Monitor )
   
10. Fractionator (Gilson, model: FC203B )
    
11. Nanodrop (or another spectrophotometer to quantify nucleic acid concentrations in small volumes of RNA)
    
12. Nutator shaker
    
13. Thermoblock
    
14. Fume hood
    
15. Mini-PROTEAN tetra cell polyacrylamide gel box (Bio-Rad Laboratories, catalog number: 165-8004 ) or equivalent and electrophoresis power supply
    
16. UV transilluminator
    
17. Vortex
    
18. DynaMag^TM-2 magnetic separation rack (Thermo Fisher Scientific, catalog number: 12321D )
    
19. Thermocycler
    
20. 2100 BioAnalyzer (Agilent Technologies, catalog number: G2940CA )
    
21. HiSeq2000 (Illumina)
    

Procedure

The wet-lab protocol is divided into A, B, and C steps (see Figure 1 for an overview). A steps regard to the preparation of the ribosome footprints. B steps refer to the total mRNA isolation procedure. C steps represent the part of the protocol where the footprints and mRNA fragments are processed together to create the sequencing libraries. The order in which A and B steps are performed is up to the researcher.
Tissues need to be flash-frozen after the desired treatment, ground to a very fine powder in liquid nitrogen, and then stored in -80 °C until use. 0.5 g of this pulverized tissue is required for the ribosome footprints and 0.5-1 g are needed to prepare the mRNA fragments. It is good practice to first isolate polysomes without including the digestion step to ensure that intact polysomes are being isolated before proceeding to the preparation of the footprint libraries. As with all RNA protocols, the tissues should not be allowed to thaw in the absence of buffer at any moment and all materials and solutions need to be RNase free. All the work should be performed on ice, unless otherwise stated.
These protocols allow for the generation of ready-to-sequence Ribo-seq and RNA-seq libraries from frozen ground tissues in 9 days. The entire protocol is organized in working days. At the end of the protocol, we include a Data analysis section that describes the pipeline that leads to the identification of genes regulated at the level of translation by the treatment or mutation of interest.


Figure 1. Overview of the ribosome footprinting procedure. A. Blue panel: steps that are specific to ribosome footprinting; B. Green panel: steps specific to mRNA library preparation; C. Yellow panel: steps that are common to both types of libraries. A, B and C steps are also marked in the written protocol.

1. Steps: Ribosome footprinting
   Figure 2 shows a flow chart of the procedure comprising the A steps.
   
   
   Figure 2. Overview of the A steps of the protocol
   
   

Data analysis

The bioinformatic analysis described herein for the study of translation regulation using ribosome footprinting data follows the pipeline described in Merchante et al. (2015). The inputs for this pipeline are the de-multiplexed Ribo-seq and RNA-seq datasets (fastq-files) from Illumina HiSeq2000 platform, the TAIR 10 Arabidopsis genome sequence, and TAIR 10 Arabidopsis gene models (https://www.arabidopsis.org/).

1. General data preprocessing
   1. Using FASTX-Toolkit (http://hannonlab.cshl.edu/fastx_toolkit/), remove adaptor sequences and trim low-quality regions.
      
   2. Align reads to the Arabidopsis thaliana genome sequence using Tophat2 (https://ccb.jhu.edu/software/tophat/index.shtml).
      
   3. Select uniquely mapping, sense-orientation reads in the size range of 20-40 nt, discard alignments with more than two mismatches, and create read count summaries of coding (CDS) regions.
      
      
2. Assessment of periodicity for quality control
   Ribosome footprints, but not the RNA-seq reads, shouldshow a strong 3 nt periodicity, which represents the codon-long step-wisemovement of the ribosome along the mRNA (Ingolia et al., 2009; Merchante et al.,2015). So, the presence of this periodicity can be used as a control of thequality of the footprints. To avoid edge effects, restrict analysis to thegenes with 5’ and 3’ UTRs longer than 70 nt and CDSs longer than 150 nt. Toavoid ambiguities with respect to the location of reads along a transcript,restrict analysis to reads of a fixed length - typically a value between 28 to32 nt, determined by visual inspection (C1 steps) - that map in senseorientation to only one transcript.
   
   1. Transform genomic read coordinates into transcript coordinates.
      
   2. Visualize read distribution in the vicinity of the CDS start: project the selected reads into the common coordinate system of a ‘metagene’. Bin the transcript coordinates of the read start points using their relative location with respect to the start of the main open reading frame: a read that starts at the beginning of the CDS falls into bin ‘0’. To visualize the read distribution around the end of the CDS, proceed analogously but bin with respect to the end of the main open reading frame.
      
   3. Normalize the histogram of read start positions by the total number of reads selected and draw a region around bin ‘0’.
      
      
3. edgeR analysis of differential transcription and translation
   1. Discard genes with small read counts (rpkm value smaller than 3 in any of the samples) and perform TMM normalization (Robinson and Oshlack, 2010).
      
   2. Model the experiment by a 2-factorial design, where factor one is, for example, ethylene/control treatment and factor two is RNA-seq/Ribo-seq treatment. Use the generalized linear models approach (glm edgeR) of the Bioconductor package edgeR (Robinson et al., 2010) to select genes that, in this example, i) respond to ethylene on the RNA level, ii) respond to ethylene on the footprint level, and iii) respond differently to ethylene on the RNA-level and the footprint level. Determine the false discovery rate using Benjamini and Hochberg’s method (Benjamini and Hochberg, 1995).
    
   
4. Analysis of changes intranslational efficiency
   1. Following the definition of Ingolia and colleagues (Ingolia et al., 2009), compute translational efficiency (TE) as the fraction of Ribo-seq footprint rpkm value over RNA-seq rpkm value: TE = rpkm(foot)/rpkm(mRNA).
      
   2. Compute log₂-transformed TE-values of ethylene-treated plants and subtract corresponding control values: ΔTE = log₂ (TE_ethylene) - log₂ (TE_control)
      
   3. Compute z-score of ΔTE: zΔTE= (ΔTE-E[ΔTE])/√Var(ΔTE). Determine the false discovery rate using the R package fdrtool (Strimmer, 2008).
      
      

Notes

1. Cycloheximide and chloramphenicol are very toxic and harmful to the environment.
   
2. Both phenol and chloroform are acute toxins. Handle them in a fume hood and wear proper protection.
   
3. The 2x denaturing sample buffer with dye contains formamide, which is a reproductive toxin. Use proper protection when handling it.
   
4. Nucleic acid stains are typically mutagenic, use proper protection when handling them.
   
5. Both acrylamide and bisacrylamide are neurotoxins, use proper protection when handling them.
   
6. Make sure not to confound the proper T4 PNK (M0201) with the T4 Polynucleotide Kinase 3’ phosphatase minus (M0236) as with the latter one the ligation step will not work.
   
7. [P] represents 5’-phosphorylation and [SC18] represents a hexa-ethyleneglycol spacer.
   
8. ‘r’ indicates that these are RNA oligonucleotides.
   
9. These oligos may need to be re-designed if different treatments, growth conditions, developmental stages, footprinting protocols, etc., are used.
   
10. This protocol requires Tris-HCl at pH 7.5, 7.8, 8.0, 8.4, 8.8 and 9.0, but all intermediate-concentration Tris-HCl buffers can be made out of the Tris-HCl pH7.0, 8.0 and 9.0 listed here.
    
11. EGTA and EDTA only dissolve after adjusting the pH.
    
12. There will be foam due to the use of detergents. Make sure to collect all the bubbles as well.
    
13. When preparing the aliquots, allow some excess as the solution is very viscous. 1.2 ml aliquots work well for two samples.
    
14. The SW55Ti rotor allows spinning 6 samples at the same time, so a maximum of 3 ml of SCA will be needed per centrifugation round.
    
15. Such as a 5 ml ultracentrifuge tube or a 15 ml Falcon tube.
    
16. This step is necessary because the debris pellet can easily get dislodged if supernatant is not transferred to a different tube rapidly at the end of the spin; failure to transfer the supernatant immediately will result in carryover of the debris and compromise ultracentrifugation.
    
17. Sucrose gradients can also be prepared at the monosome pelleting centrifuge-step A2.7.
    
18. Approximately half of the tube.
    
19. The polysome pellet will be clear if using etiolated seedlings and dark green if photosynthetic tissues are employed.
    
20. If there is a control tube that is not going to be digested, do not add the RNase I to it and keep it on ice until digestion time is over.
    
21. Be extra-careful when doing this to not disturb the gradient.
    
22. If using 1.5 ml tubes to heat the phenol:chloroform, do not allow the temperature to get higher than 65 °C and secure the lids, as, due to the pressure, the lids can open quite easily and produce dangerous spills, leading to the loss of precious samples.
    
23. Phenol alone can also be used to extract the RNA, but if this is the case, the aqueous phase can be the lower one due to the high concentration of sucrose in the extract.
    
24. Other standard RNA extraction methods (e.g., Trizol) compatible with high-throughput sequencing library construction and next-gen sequencing can also be used.
    
25. Phenol:Chloroform:Isoamylalcohol (25:24:1) can also be used.
    
26. JA17 tubes in the Beckman Avanti J-25 can also be used.
    
27. If using 2 ml centrifuge tubes, add 500 μl of extract to different microtubes prefilled with 50 μl 3 M sodium acetate pH 5.2, mix and add 1,375 μl of ethanol.
    
28. 34,895 x g if the Beckman centrifuge is used.
    
29. At this step, samples can be left overnight at 4 °C if necessary.
    
30. The stop solution already contains 300 mM salt, so no more salt is needed to precipitate the RNA.
    
31. It is easier to select the size if the samples are surrounded by the oligos, so, run two oligo lanes, at the beginning and end of the gel.
    
32. The time of the run has to be determined empirically depending on the running cell. It is a good practice to start running a test with the primers. As a reference, for the first run do not let the lower blue band from the denaturing sample buffer run out of the gel. Note the position of the marker primers with respect to the dye and adjust the future run times to the primer test.
    
33. The gel piece does not disintegrate or change appearance.
    
34. Allow a relatively high excess as the mix is very viscous and difficult to pipette.
    
35. If the room-temperature incubation is followed by an overnight incubation at 4 °C, ligation efficiency increases.
    
36. As a reference, the ligated samples typically run just above the higher blue band of the sample buffer.
    
37. When the primer is present in vast excess, there is increased background from unextended primer that can, in some cases, dominate the actual library products. It is best to determine the right proportion empirically. 1-2 μl of NI-NI-9 primer at 1.25 μM should work fine. This can be tested in the gel run afterwards: the unextended primer should still be present after the RT step, but the extended libraries should not be fainter than the primer itself.
    
38. The circularized libraries were resuspended in 20 µl and only 10 µl are used for the subtractive hybridization step. Keep the remaining 10 µl at -80 °C as a back-up.
    
39. The buffer conditions in the subtractive hybridization (high salt as well as citrate, which chelates magnesium) are incompatible with PCR and thus precipitation is required after the subtraction step.
    
40. Look for the cycle number that results in the best amplification without a significant loss of primers, so that there won’t be competition between sequences for the primers. The conditions are usually stable between experiments. Therefore, once the optimal conditions have been determined for a subset of samples, they also prove suitable for other samples from different experiments. In our case, the best amplification was achieved at 14 cycles, and further tests with additional samples confirmed 14 cycles as optimal, negating the need for further optimization.
    
41. Keep the rest of the PCR as a back-up.
    

Recipes

1. Polysome extraction buffer (PEB)
   110 mM Tris-HCl, pH 8.8
   100 mM sucrose
   100 mM KCl
   75 mM NaCl
   20 mM MgCl₂
   12.5 mM EGTA
   3 mM DTT
   6.25 μl/ml detergent mix
   25 μl/ml Triton X-100
   37.5 μg/ml cycloheximide
   25 μg/ml chloramphenicol
   Prepare fresh before the extraction and keep on ice until use
   
2. Sucrose cushion A (SCA)
   1.75 M sucrose
   400 mM Tris-HCl, pH 9.0
   200 mM KCl 
   5 mM EGTA
   35 mM MgCl₂
   5 mM DTT
   50 μg/ml cycloheximide
   50 μg/ml chloramphenicol
   Prepare in advance (minus DTT and antibiotics). Autoclave no longer than 15 min, make 1.2 ml aliquots and store at -20 °C. Add the last three compounds fresh for each experiment before use.
   
3. Sucrose gradients solutions
   50%/10% (w/v) sucrose
   40 mM Tris-HCl, pH 8.4
   20 mM KCl
   10 mM MgCl₂
   50 μg/ml cycloheximide
   50 μg/ml chloramphenicol
   1 μg/ml SUPERase-In
   Prepare fresh on the day of the experiment
   
4. Polysome digestion buffer (PDB)
   20 mM Tris-HCl, pH 7.8
   150 mM NaCl
   5 mM MgCl₂
   50 μg/ml Triton X-100
   1 mM DTT
   100 μg/ml cycloheximide
   12 μl TURBO DNase 2 U/μl per 4.5 ml of digestion volume
   10 μl RNase I per 4.5 ml of digestion buffer
   Prepare on the day of the extraction and keep on ice 
   
5. Sucrose cushion B (SCB)
   1.75 M sucrose
   20 mM Tris-HCl, pH 7.8
   150 mM NaCl
   5 mM MgCl₂
   5 mM DTT
   50 μg/ml cycloheximide
   50 μg/ml chloramphenicol
   1 μl/ml SUPERase-In
   Prepare in advance (minus the last four ingredients) and autoclave no longer than 15 min. Make 1.2 ml aliquots and store at -20 °C. Add the last four compounds fresh for each experiment before use.
   
6. Polysome resuspension buffer (PRB)
   200 mM Tris-HCl, pH 8.4
   200 mM KCl
   25 mM EGTA
   35 mM MgCl₂
   50 μg/ml cycloheximide
   50 μg/ml chloramphenicol
   1 μl/ml SUPERase-In
   Prepare the day of the extraction and keep in ice
   
7. Total RNA extraction buffer (TREB)
   200 mM Tris-HCl, pH 8.0
   400 mM LiCl
   25 mM EDTA
   1% SDS
   Prepare in advance (the solution keeps for several months) and store at room temperature
   
8. Alkaline fragmentation buffer (2x)
   2 mM EDTA
   100 mM Na₂CO₃, pH 9.2
   This solution is prepared by mixing 15 parts of 100 mM Na₂CO₃ with 110 parts of 100 mM NaHCO₃. It will equilibrate with gaseous CO₂ and raise in pH over time. It can be stored in tightly capped, single-use aliquots at room temperature for over a year.
   
9. Alkaline fragmentation stop/precipitation solution
   60 μl 3 M NaOAc
   2 μl GlycoBlue 15 mg/ml
   500 μl RNase-free water per reaction
   Prepare right before use
   
10. TAE (Tris/acetate/EDTA buffer) (50x)
    2 M Tris base
    1 M acetic acid
    50 mM EDTA
    
11. TBE (Tris/Borate/EDTA buffer) (5x)
    445 mM Tris base
    445 mM boric acid
    10 mM EDTA
    Dilute the concentrated stock buffer to 1x right before use.
    
12. RNA gel extraction buffer (GEB)
    300 mM NaOAc, pH 5.5
    1 mM EDTA
    0.25% SDS
    
13. DNA gel extraction buffer (STE)
    300 mM NaCl
    10 mM Tris-HCl, pH 8.0
    1 mM EDTA
    
14. SSC (20x)
    3 M NaCl
    300 mM trisodium citrate (Na₃C₆H₅O₇)
    Adjusted to pH 7.0 with HCl
    
15. Subtraction bind/wash buffer (2x)
    400 μl 5 M NaCl
    2 μl 0.5 M EDTA
    10 μl 1 M Tris-HCl, pH 7.5
    590 μl water
    
16. 8% non-denaturing polyacrylamide gel (12 ml)
    6.3 ml MilliQ water
    3.2 ml 30% acrylamide/bisacrylamide
    2.4 ml of 5x TBE
    84 μl of 10% APS
    10 μl TEMED
    
17. Non-denaturing loading dye (6x)
    60% (v/v) glycerol
    0.03% (w/v) bromophenol blue
    

Acknowledgments

This work was supported by NSF grants MCB 1158181 and 0519869 to J.M.A.; MCB 0923727 to J.M.A. and A.N.S.; IOS 1444561 to J.M.A., A.N.S., and S.H.; NCSU-RISF to S.H. and J.M.A.; and a Marie Curie COFUND U-Mobility postdoctoral fellowship to C.M. (co-funded by the University of Malaga and the EU 7FP GA N_246550). We are grateful to Nick Ingolia for his help with implementing and troubleshooting this protocol in plants.

References

1. Branco-Price, C., Kaiser, K. A., Jang, C. J., Larive, C. K. and Bailey-Serres, J. (2008). Selective mRNA translation coordinates energetic and metabolic adjustments to cellular oxygen deprivation and reoxygenation in Arabidopsis thaliana. Plant J 56(5): 743-755. 
   
2. Benjamini, Y. and Hochberg, Y. (1995). Controlling the false discovery rate: a practical and powerful approach to multiple testing. J. R. Statist. Soc. B 57: 125-133.
   
3. Ingolia, N. T., Ghaemmaghami, S., Newman, J. R. and Weissman, J. S. (2009). Genome-wide analysis in vivo of translation with nucleotide resolution using ribosome profiling. Science 324(5924): 218-223. 
   
4. Ingolia, N. T., Brar, G. A., Rouskin, S., McGeachy, A. M. and Weissman, J. S. (2013). Genome-wide annotation and quantitation of translation by ribosome profiling. Curr Protoc Mol Biol Chapter 4: Unit 4 18. 
   
5. Juntawong, P., Girke, T., Bazin, J. and Bailey-Serres, J. (2014). Translational dynamics revealed by genome-wide profiling of ribosome footprints in Arabidopsis. Proc Natl Acad Sci U S A 111(1): E203-212. 
   
6. Li, R., Sun, R., Hicks, G. R. and Raikhel, N. V. (2015). Arabidopsis ribosomal proteins control vacuole trafficking and developmental programs through the regulation of lipid metabolism. Proc Natl Acad Sci U S A 112(1): E89-98.
   
7. Mustroph, A., Juntawong, P. and Bailey-Serres, J. (2009). Isolation of plant polysomal mRNA by differential centrifugation and ribosome immunopurification methods. Methods Mol Biol 553: 109-126.
   
8. Merchante, C., Brumos, J., Yun, J., Hu, Q., Spencer, K. R., Enriquez, P., Binder, B. M., Heber, S., Stepanova, A. N. and Alonso, J. M. (2015). Gene-specific translation regulation mediated by the hormone-signaling molecule EIN2. Cell 163(3): 684-697.
   
9. Missra, A. and von Arnim, A. G. (2014). Analysis of mRNA translation states in Arabidopsis over the diurnal cycle by polysome microarray. Methods Mol Biol 1158: 157-174.
   
10. Reynoso, M. A., Juntawong, P., Lancia, M., Blanco, F. A., Bailey-Serres, J. and Zanetti, M. E. (2015). Translating Ribosome Affinity Purification (TRAP) followed by RNA sequencing technology (TRAP-SEQ) for quantitative assessment of plant translatomes. Methods Mol Biol 1284: 185-207.
    
11. Reuber, T. L. and Ausubel, F. M. (1996). Isolation of Arabidopsis genes that differentiate between resistance responses mediated by the RPS2 and RPM1 disease resistance genes. Plant Cell 8(2): 241-249.
    
12. Robinson, M. D. and Oshlack, A. (2010). A scaling normalization method for differential expression analysis of RNA-seq data. Genome Biol 11(3): R25.
    
13. Robinson, M., McCarthy, D., and Smyth, G. (2010). edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26(1):139-40.
    
14. Strimmer, K. (2008). A unified approach to false discovery rate estimation. BMC Bioinformatics 9: 303.
    
15. Zanetti, M. E., Chang, I. F., Gong, F., Galbraith, D. W. and Bailey-Serres, J. (2005). Immunopurification of polyribosomal complexes of Arabidopsis for global analysis of gene expression. Plant Physiol 138(2): 624-635.