Materials and Reagents

CellTrics 50 μm sterile Disposable Filters (Sysmex, catalog number: 04-004-2327)
96-well plate (Ibidi, 15 μ-Plate 96 Well Black)
12-well cell culture plate (Corning, catalog number: 3513)
25 or 75 cm² cell culture flasks (Corning, catalog number: 430639 or 430641U)
15 mL tube conical base (Sarstedt, catalog number: 62.554.205)
DNA oligonucleotide primers from IDT
GeneArt Precision gRNA Synthesis kit (Invitrogen, catalog number: A29377)
Tracr Fragment + T7 Primer Mix (contains the universal PCR amplification primers and the 80-nt constant region of the crRNA/tracrRNA) (Invitrogen, catalog number: A29377)
Phusion^TM High-Fidelity PCR Master Mix (2×) (Invitrogen, catalog number: A29377)
Nuclease free water
dNTP mix (10 mM each of dATP, dGTP, dCTP, dTTP) (NEB, catalog number: N0447)
5× TranscriptAid^TM Reaction Buffer (Invitrogen, catalog number: A29377)
TranscriptAid^TM Enzyme Mix (Invitrogen, catalog number: A29377)
DNase I (Invitrogen, catalog number: A29377)
Single stranded DNA (ssDNA) oligos from IDT
NEBuilder^® HiFi DNA Assembly Master Mix (NEB, catalog number: E2621)
pSpCas9(BB)-2A-Puro (PX459) plasmid (Addgene plasmid # 62988)
BbsI (NEB, catalog number: R0539)
NEB Buffer 2 (NEB, catalog number: B7002S)
NEB^® 5-α Competent E. coli (High Efficiency) (NEB, catalog number: C2987)
Ampicillin Agar plates and Kanamycin Agar plates
NEB buffer 2.1 (NEB, catalog number: B7202)
QIAquick PCR Purification Kit (Qiagen, catalog number: 28104)
Synthetic double stranded donor DNAs from IDT
Phusion High-Fidelity DNA Polymerase (NEB, catalog number: M0530)
Phusion GC buffer 5× (NEB, catalog number: B0519)
Zero Blunt^TM TOPO^TM PCR Cloning Kit (Invitrogen, catalog number: 45-1245)
EcoRI-HF (NEB, catalog number: R3101)
CutSmart Buffer 10× (NEB, catalog number: B6004)
QIAquick Gel Extraction Kit (Qiagen, catalog number: 28704)
XbaI (NEB, catalog number: R0145)
Easy-Fusion Halo plasmid (Addgene plasmid # 112850)
EcoRI-HF (NEB, catalog number: R3101)
AvaI (NEB, catalog number: R0152)
HincII (NEB, catalog number: R0103)
DMEM (Gibco, catalog number: 11965-092) with 10% FBS (Invitrogen, catalog number: 16140071)
DPBS (without Ca²⁺ or Mg²⁺) (Gibco, catalog number: 14190-144)
Trypsin (Gibco, catalog number: 25200-056)
Neon Transfection System (Invitrogen, catalog number: MPK5000)
Neon Transfection System 10 μL Kit (Invitrogen, catalog number: MPK1025)
Buffer R
Puromycin (Sigma-Aldrich, catalog number: P8833)
Platinum Cas 9 (Invitrogen, catalog number: A36498)
BD FACSAria III sorter fitted with 488 100 mW Trigon laser and 100 μm nozzle (BD Biosciences)
Nocodazole (Sigma-Aldrich, catalog number: M1404)
Lipofectamine 3000 (Invitrogen, catalog number: L3000001)
OptiMEM (Invitrogen, catalog number: 31985062)
Recombinant KRAS rabbit monoclonal antibody (Thermo Fisher Scientific, catalog number: 703345)
Cell Sorting buffer (see Recipes)
TGH buffer (see Recipes)

Software

https://www.benchling.com/. Benchling is a cloud-based informatics platform that is free to academic researchers. It provides design tools for DNA, oligonucleotides, and amino acids.
https://portals.broadinstitute.org/gppx/crispick/. The website is hosted by the Genetic Perturbation Platform of the Broad institute, MA, USA.
http://chopchop.cbu.uib.no/. CHOPCHOP is a web-based tool, designed by the Valen group at the University of Bergen, Norway. The website is for non-profit and academic use only.
https://nebuilder.neb.com. The web tool can be used to design primers for HiFi DNA assembly or Gibson assembly.

Procedure

Experimental Design

Figure 1. Schematics of insertion of mNG in KRAS, NRAS, and Grb2. mNG sequence was inserted at amino terminus of KRAS and NRAS genes (A) and at carboxy terminus of Grb2 gene (B). Donor DNAs were generated for all three genes with homology arms ranging from 500 to 1,000 bp. ATG, Start codon; STOP, Stop codon; HA, Homology Arm; mNG, mNeongreen; gRNA-guide RNA; empty boxes represent exons of KRAS, NRAS and Grb2.

Table 1. Sources of the components used to tag the genes

	KRAS	NRAS	Grb2
Cas9	Commercial purified enzyme	Commercial purified enzyme	Plasmid -PX459
gRNA	In vitro transcribed	In vitro transcribed	Cloned in Plasmid- PX459
Donor	Synthetic gene fragment	Synthetic gene fragment	Homology arms and mNG fragments cloned in a plasmid
Delivery method	Electroporation	Electroporation	Transfection via Lipofectamine

Generation of gRNAs for KRAS, NRAS, and Grb2

In-vitro Synthesis of gRNAs for tagging KRAS and NRAS

Identification of the target gRNA

We used amino termini of both KRAS and NRAS genes to tag with mNeonGreen fluorescent protein sequence because all RAS proteins are processed at their carboxy termini (Figure 1). Several guide RNA design tools are available online. We routinely use Benchling, Broad Institute GPP (now CRISPick), and CHOPCHOP, among others, to design target gRNAs. Using these tools, two targets for both KRAS and NRAS were identified, which were very close to the Start codons of both the genes. Order two complementary primers for each target (Table 2).

Table 2. Primers for in vitro translation of gRNAs

Primer	Sequence 5’--- 3’
Kras_1F	TAATACGACTCACTATAGGAATATAAACTTGTGGTAGT	Target 1
Kras_1R	TTCTAGCTCTAAAACACTACCACAAGTTTATATTC	Target 1
Kras_2F	TAATACGACTCACTATAGAATGACTGAATATAAACTTG	Target 2
Kras_2R	TTCTAGCTCTAAAACCAAGTTTATATTCAGTCATT	Target 2
Nras_1F	TAATACGACTCACTATAGGACTGAGTACAAACTGGTGG	Target 1
Nras_1R	TTCTAGCTCTAAAACCCACCAGTTTGTACTCAGTC	Target 1
Nras_2F	TAATACGACTCACTATAGAATGACTGAGTACAAACTGG	Target 2
Nras_2R	TTCTAGCTCTAAAACCCAGTTTGTACTCAGTCATT	Target 2

Dilute target primers to a stock solution 100 μM in 1× TE buffer.
Prepare a mixture of target primers of 10 μM stock solution by adding 10 μL each of the 100 μM forward and reverse target primer to 80 μL of nuclease-free water.
Prepare the 0.3 μM target primer mix working solution by diluting 3 μL of the 10 μM target primer mix stock solution in 97 μL of nuclease-free water.

Assembly of the gRNA DNA templates
This step generates the DNA template required for the in vitro transcription of the gRNAs. Thaw the reagents from GeneArt Precision gRNA synthesis kit on ice. Mix and centrifuge contents of all the vials. Set up the following PCR assembly reaction in a 25-μL volume, adding the reaction components in the order given (Table 3).

Table 3. Components to make gRNA DNA template
Phusion^TM High-Fidelity PCR Master Mix (2×) 12.5 μL
Tracr Fragment + T7 Primer Mix 1 μL
0.3 μM Target F/R oligonucleotide mix 1 μL
Nuclease free water 10.5 μL

Since the PCR product is expected to be very short (120 bp), perform a two-step assembly PCR using following parameters (Table 4).

Table 4. PCR parameters to generate gRNA DNA template
Cycle Step Temperature Time Cycles
Initial denaturation 98°C 10 s 1×
Denaturation 98°C 5 s 32×
Annealing 55°C 15 s 32×
Final extension 72°C 1 min 1×
Hold 4°C Hold 1×
In vitro transcription (IVT) of gRNAs
Use the gRNA DNA template generated in step A.1.b for in vitro transcription of gRNAs. Set up the reaction as follows in the order given (Table 5).

Table 5. Components of IVT reaction
NTP mix (100 mM each of ATP, GTP, CTP, UTP) 8 μL
gRNA DNA template (from PCR assembly) 6 μL
5× TranscriptAid^TM Reaction Buffer 4 μL
TranscriptAid^TM Enzyme Mix 2 μL
Mix the contents thoroughly and centrifuge. Carry out the IVT reaction for 3 h at 37°C.
Removal of the DNA template by DNase I digestion
It is helpful to remove DNA from IVT reaction so that it does not interfere with the subsequent applications of the RNA transcript.
1. Incubate the IVT reaction mix with 1 μL of DNase I (1 U/μL) immediately after the IVT reaction and incubate at 37°C for 15 min.
Purification of gRNAs using the columns and the buffers supplied in the kit
1. Dilute the IVT reaction to 200 μL with nuclease-free water and add 100 μL of Binding Buffer. Mix by pipetting.
2. Add 300 μL of ethanol (>96%) and mix by pipetting.
3. Transfer the mixture to the GeneJET^TM RNA Purification Micro Column (preassembled with a collection tube) and centrifuge for 30–60 s at 14,000 × g. Discard the flow-through
4. Wash the bound RNA with 700 μL Wash Buffer 1 and Wash Buffer 2.
5. Centrifuge the empty purification column for an additional 60 s at 14,000 × g to completely remove any residual Wash Buffer.
6. Transfer the purification column to a clean 1.5-mL Collection Tube.
7. Add 10 μL of nuclease-free water to the center of the purification column filter, and centrifuge for 60 s at 14,000 × g to elute the RNA.
8. Store eluted gRNA at –20 °C until use. For prolonged storage, store the gRNA at -80°C.
  Note: Follow all the necessary precautions while working with RNA to avoid its degradation or contamination and refer to the manufacturer’s instructions for detailed guidelines for generating gRNAs.

Cloning of gRNAs for tagging Grb2
1. Identification of the target gRNA
  Grb2 was tagged with mNG at its carboxy terminal. Cloning of Grb2 gRNAs was performed using NEBuilder HiFi DNA assembly mix which allows assembly of a linear plasmid and a single stranded DNA fragment, just as multiple DNA fragments assembly. Similar to RAS proteins, two target gRNAs for Grb2 were identified using Benchling and Broad Institute GPP (now CRISPick). The following target gRNA sequence oligos were ordered as ssDNA from IDT (Table 6). Underlined sequences represent the actual target gRNA sequence flanked by overlapping sequences around BbsI restriction enzyme cut site from PX459.
  
  Table 6. ssDNA oligos for Grb2 gRNA
  grb2-RNA_T1 ATCTTGTGGAAAGGACGAAACACCGGGTTAGACGTTCCGGTTCACGGGTTTTAGAGCT AGAAATAGCAAGTT
  grb2- gRNA_T2 ATCTTGTGGAAAGGACG AAACACCGGGCTTAG ACGTTCCGGTTCACGGTTTTAGAGCTAGAAATAGCAAGTT
2. Digestion of PX459 with BbsI
  Linearize PX459 plasmid by digestion with BbsI at 37°C for 4 h (Table 7). Purify the digested plasmid using QIAquick PCR purification kit.
  
  Table 7. PX459 digestion set up
  PX459 Plasmid (500 ng/μL) 10 μL
  10× Buffer 2.1 2 μL
  BbsI (10 U/μL) 1 μL
  ddH₂O 7 μL
3. Ligation of ssDNA into digested PX459
  Centrifuge ssDNA oligo pellet and resuspend it in 1× TE to a final concentration of 100 μM, which is further diluted to a working stock of 0.4 μM in NEB Buffer 2. Set up the ligation reaction of linearized PX459 and ssDNA oligos in the order given below (Table 8).
  
  Table 8. HiFi DNA assembly set up
  Linear PX459 plasmid (50 ng) 1 μL
  0.4 μM ssDNA stock 5 μL
  ddH₂O 4 μL
  NEBuilder^® HiFi DNA Assembly Master Mix 10 μL
  Incubate assembly reaction at 50°C for 1 h and transform 2 μL of the reaction mix into NEB 5-α Competent E. coli cells. Select the ampicillin resistant colonies by plating transformed E. coli cells onto Ampicillin agar plates.
4. Screening and confirmation of the positive clones
  Select a few colonies from the ampicillin plates for plasmid isolation. Confirm the positive clones containing gRNA sequences by Sanger sequencing.

Generation of donor DNAs for tagging KRAS, NRAS, and Grb2

Cloning of donor DNA for tagging KRAS and NRAS

Donor DNAs with mNG sequence flanked by 5’ and 3’ homology arms of approximately 500 b each were obtained from IDT as gene fragments. The fragments were amplified using primers and cloned into pCRBluntII-TOPO plasmid using TOPO PCR cloning kit.

Amplification of the donor DNAs

Centrifuge vials containing gene fragments to collect the precipitate in 50 μL 1× TE. Amplify the synthetic DNA using Phusion polymerase (Tables 10 and 11) and primers mentioned below (Table 9).

Table 9. Primers for amplification of KRAS and NRAS synthetic donor DNA

Primers	5’------------3’
KRas_5HAF	AGGTGGGGGTCCACTAGGAA
KRas_3HAR	CATATGATGTCACAATACCAAGAAAC
NRas_5HAF	CAGAGGCAGTGGAGCTTG
NRas_3HAR	ACAATCAGACAGTCTCGCTACTAT

Table 10. PCR set up for amplification of KRAS and NRAS synthetic donor DNA

	KRAS donor DNA	NRAS Donor DNA
Donor gene fragment	5 μL	5 μL
Phusion GC Buffer 5×	10 μL	10 μL
10mM dNTP	1 μL	1 μL
5HAF	2.5 μL	2.5 μL
3HAR	2.5 μL	2.5 μL
Phusion Polymerase	1 μL	1 μL
Nuclease free water	28 μL	28 μL

Table 11. PCR parameters for amplification of KRAS and NRAS synthetic donor DNA

Cycle Step	Temperature	Time	Cycles
	KRAS donor	NRAS donor
Initial denaturation	98°C	98°C	1 min	1×
Denaturation	98°C	98°C	15 s	30×
Annealing	61.6°C	64.7°C	15 s	30×
Extension	72°C	72°C	1 min	30×
Final extension	72°C	72°C	10 min	1×
Hold	4°C	4°C	Hold	1×

Perform gel purification of 1.68 kb of PCR products from KRAS and NRAS amplified donor DNAs.

Ligation of amplified donor DNAs and pCRBluntII-TOPO plasmid
Set up ligation reaction of gel eluted KRAS and NRAS donor DNAs and pCRII-Blunt-TOPO plasmid in a 6 μL volume as follows (Table 12).

Table 12. Donor DNA and pCRBluntII-TOPO ligation set up
KRAS Donor NRAS Donor
Gel eluted fragment 2 μL 2 μL
Salt Solution 1 μL 1 μL
Nuclease free water 2 μL 2 μL
pCR-II-Blunt-TOPO 1 μL 1 μL
Incubate the ligation reaction at room temperature for 5 min. Transform 1–2 μL of the ligation mixture into competent E. coli and plate on kanamycin containing plates for selection.
Screening and confirmation of donor DNAs
Select few colonies from kanamycin plates and grow them to isolate plasmid. Confirm the positive clones by EcoRI digestion and by Sanger sequencing to make sure there are no changes in the donor sequence.
Digestion and gel elution of donor DNA sequences from positive clones
The fragments are inserted in pCRII-Blunt-TOPO in such a way that EcoRI sites lie at the ends of the insert, allowing recovery of the insert by EcoRI digestion. Digest the positive clones containing donor sequences with EcoRI as follows (Table 13).

Table 13. Digestion of pCR-II-Blunt-TOPO-Donor plasmid
KRAS NRAS
pCR-II-Blunt-TOPO-Donor (1 μg/μL) 20 μL 20 μL
CutSmart buffer 10× 5 μL 5 μL
EcoRI-HF (10 U/μL) 3 μL 3 μL
Nuclease free water 22 μL 22 μL
Carry out the digestion for 3 h at 72°C. Gel elute the 1.68 kb bands from both the samples. Store the eluted donor fragments at -20°C.
Note: The donor PCR fragments were cloned to facilitate the confirmation of correct donor sequence using Sanger sequencing and to avoid repeated amplification. Purified PCR fragments can be used directly as donor DNAs, thus reducing the time of cloning.

Cloning of donor DNA for tagging Grb2

To clone donor DNA for Grb2 gene editing, 5’ and 3’ homology arms (HA) were amplified from HeLa genomic DNA using primers designed by the NEbuilder algorithm (NEB), whereas KRAS donor DNA was used as a template to amplify mNG ORF. The primers add overlapping sequences to the resulting PCR fragments and these fragments are then assembled with Easy-Fusion Halo plasmid using NEBuilder^® HiFi DNA Assembly Master Mix (Table 14).

Table 14. Component Fragments for HiFi DNA assembly

Name	Length (bp)	Produced by
5HA fragment	793	PCR
3HA fragment	743	PCR
mNG fragment	755	PCR
EasyFusion halo plasmid as backbone vector	2,927	Restriction Digestion

Amplification of homology arms (HA) and mNG ORF

Design primers with overlapping sequences using NEBuilder algorithm (Table 15). Amplify all three fragments required for the construction of the donor DNA as follows (Tables 16, 17, and 18).

Table 15. Primers for amplification of Grb2 homology arms and mNG ORF

Primer	5’……………..3’
Grb2-5HA_f	TATCGATAAGCTTGATATCGAGAGGCAGTGTGTAGCCAG
Grb2-5HA_r	CTCCTCCTAAGACGTTCCGGTTCACGGG
Grb2-Neon_f	CCGGAACGTCTTAGGAGGAGGAGGATCAG
Grb2-Neon_r	TTGACTCTTACTTGTACAGCTCGTCCATG
Grb2-3HA_f	GCTGTACAAGTAAGAGTCAAGAAGCAATTATTTAAAG
Grb2-3HA_r	CCACCGCGGTGGCGGCCGCTTCTCGAACTCCTGACCTTG

Table 16. PCR set up for amplification of Grb2 HAs

	5HA Fragment	3HA Fragment
HeLa genomic DNA (100 ng/μL)	3 μL	3 μL
Phusion GC Buffer 5×	10 μL	10 μL
10 mM dNTP	1 μL	1 μL
Grb2-5/3HA_f	2.5 μL	2.5 μL
Grb2-5/3HA_r	2.5 μL	2.5 μL
Phusion Polymerase	1 μL	1 μL
Nuclease free water	30 μL	30 μL

Table 17. PCR set up for amplification of mNG ORF

	mNG Fragment
mNG-KRAS donor (100 ng/μL)	3 μL
Phusion GC Buffer 5×	10 μL
10mM dNTP	1 μL
Grb2-Neon_f	2.5 μL
Grb2-Neon_r	2.5 μL
Phusion Polymerase	1 μL
Nuclease free water	30 μL

Table 18. PCR parameters for amplification of Grb2 HAs and mNG ORF

Cycle Step	Temperature			Time	Cycles
	5HA	3HA	mNG
Initial denaturation	98°C	98°C	98°C	1 min	1×
Denaturation	98°C	98°C	98°C	15 s	30×
Annealing	64.4°C	60°C	59.6°C	15 s	30×
Extension	72°C	72°C	72°C	25 s	30×
Final extension	72°C	72°C	72°C	10 min	1×
Hold	4°C	4°C	4°C	Hold	1×

Gel elute the PCR products using QIAquick Gel Extraction Kit and estimate the DNA concentration of the eluted fragments.

Restriction enzyme digestion of EasyFusion-Halo plasmid.
Digest EasyFusion-Halo plasmid with EcoRI and XbaI to remove the Halo insert at 37°C for 4 h (Table 19).

Table 19. Digestion of EasyFusion-Halo plasmid to remove Halo insert
EasyFusion-Halo (5 μg) 10 μL
CutSmart buffer 10× 2 μL
EcoRI 2 μL
XbaI 2 μL
Nuclease free water 2 μL
Gel elute the 2.9 kb fragment of the digested plasmid using QIAquick Gel Extraction Kit and estimate the DNA concentration of the eluted fragment.
HiFi DNA assembly ligation reaction
Mix all four fragments required for the generation of Grb2 donor DNA to a final volume of 10 μL. Thaw HiFi DNA assembly mix on ice and vortex thoroughly. Add equal volume of HiFi DNA assembly master mix to the fragments (Table 20).

Table 20. Ligation set up for the generation of Grb2 donor DNA
0.1 pmol of 5HA 50 ng 0.8 μL
0.1 pmol of mNG 50 ng 0.9 μL
0.1 pmol of 3HA 50ng 1.1 μL
0.1 pmol of digested vector 185 ng 2 μL
HIFi DNA assembly master mix 10 μL
Nuclease free water 5.2 μL
Carry out the ligation reaction at 50°C for 1 h. Transform 2 μL of the reaction mix into competent E. coli. Screen several colonies for positive clones containing all three fragments (5HA-mNG-3HA) using restriction enzyme digestion and Sanger sequencing.

Delivery of gRNAs and Donor DNAs in HeLa cells
1. Electroporation of RNP complex to tag KRAS and NRAS
  1. Grow HeLa cells in DMEM with 10% FBS to 90% confluency in a 75 cm² flask. Treat the cells with 100 ng/mL Nocodazole for 12 h.
  2. On the day of the electroporation, thaw and store buffer R, KRAS and NRAS specific in vitro transcribed gRNA, and donor DNAs on ice. Dilute gRNAs and donor DNA to appropriate concentrations in nuclease free water.
  3. Wash away Nocodazole with 1× DPBS. Split the cells with Trypsin and inactivate it by the addition of FBS containing DMEM. Centrifuge the single cell suspension at 300 × g for 5 min. Resuspend the pellet in 10 mL of DMEM with 10% FBS. Perform cell counting using hemocytometer.
  4. Prepare RNP mixture as follows (Table 21), one for each gene-editing reaction in a 1.5 mL microcentrifuge tube.
    
    Table 21. Components of RNP mixture for electroporation
    Buffer R 1 μL
    Platinum Cas9 (1 μg) 0.5 μL (1 μg)
    gRNA (500 ng) 2 μL
  5. Incubate RNP complex at room temperature for 20 min.
  6. While the RNP is incubating, prepare electroporation set up and keep cells ready for the electroporation by centrifuging them at 300 × g for 5 min. Aspirate DPBS and resuspend the cell pellet to a final cell density of 8 × 10⁷ cells/ml in buffer R.
  7. Add 3 mL of Electrolytic buffer (Buffer E) into the Neon Pipette station.
  8. Add 5 μL of cells (final 4 × 10⁵ cells) and 1 μg of respective donor DNA fragments to the RNP mixture. Make sure the volume of the final mixture is 10 μL. Aspirate the final mix in Neon Tip using Neon Pipette without incorporating air bubbles and electroporate at pulse voltage of 1,005 V, pulse width of 35 ms for 2 pulses.
  9. Transfer the electroporated cells in a 12-well plate containing prewarmed DMEM with 10% FBS without antibiotics and continue incubating the plate at 37°C in a CO₂ incubator.
2. Transfection of gRNA and donor to tag Grb2
  1. Grow HeLa cells in DMEM with 10% FBS to 90% confluency in 12-well plates. Treat the cells with 100 ng/mL Nocodazole for 12 h.
  2. On the day of the transfections, dilute PX459-Grb2-gRNAs and Grb2-mNG donor DNA plasmids to appropriate concentrations in nuclease free water.
  3. Wash away Nocodazole with 1× DPBS. Add 1 mL of fresh FBS containing DMEM.
  4. Prepare DNA-lipid mixture as follows (Table 22), in a 1.5 mL microcentrifuge tube in the order given.
    
    Table 22. Components of transfection mixture to tag Grb2
    Tube 1
    OptiMEM 50 μL
    PX459-Grb2-gRNA (250 ng) 0.5 μL
    Grb2-mNG donor (750 ng) 1 μL
    P3000 reagent 2 μL
    Tube 2
    OptiMEM 50 μL
    Lipofectamine 3000 Reagent 1.5 μL
  5. Add contents from Tube 1 to Tube 2. Incubate the mixture at RT for 10 min.
  6. Add plasmid-lipid mixture to the cells dropwise.
  7. Next day after the transfection, treat transfected cells with 2 μg/mL of puromycin for 48 h to enrich transfected cells by killing un-transfected cells.
  8. Remove puromycin containing DMEM, wash the cells with DPBS twice and allow the cells to recover. Split the surviving cells and expand them for flow sorting analysis.
Flow Sorting of mNG positive cells
1. Expand tagged HeLa cells in DMEM with 10% FBS in 25 or 75 cm² flasks.
2. On the day of sorting, split the cells using Trypsin and inactivate it with FBS containing DMEM. Centrifuge the cells and wash once with PBS. Resuspend the final pellet in Cell sorting buffer.
3. Pass the cell suspension through disposable filters to get rid of cell aggregates just before the sorting. Use positive (parental HeLa cells transiently or stably expressing mNG) and negative (parental untagged HeLa cells) controls to calibrate the sorting instrument.
4. Collect single sorted cells in 96-well plate or in a 15 mL conical tube as a pooled population with prewarmed DMEM with 10% FBS and antibiotics to prevent contamination.
Confirmation of positive clones
1. Freeze at least one vial of single cell clones as a backup before using them for confirmation.
2. Clones can be confirmed by Western blot analysis using protein-specific antibody or mNG antibody. The correct fusion protein should have an apparent molecular mass ~25 kD larger than the parental protein. It is also important to sequence the region around the site of mNG sequence insertion to make sure there are no unwanted insertions or deletions during homology repair.
  Note: Head-to-head comparison of efficiency of different delivery methods was not performed. In all the cases, the yield of mNG positive cells as determined during flow sorting was 0.1% to 0.5%. Since we were interested in single cell colonies for screening, one 96 well plate of single sorted cells was sufficient to screen them. It should be noted that flow sorting could inadvertently result in clones expressing higher yields of fusion protein.

Data analysis

Characterization of the tagged cell line clones
Select several colonies arising from flow sorted population. Process the colonies for DNA isolation for Sanger sequencing and for making lysates for Western blot analysis. To generate PCR products for Sanger sequencing, design primers that can amplify the region beyond the homology arms. The sequencing should reveal the correctly inserted mNG sequence as well as linkers and start/stop codons. Western blot should reveal the correct molecular weight of the fusion protein. For example, a screen of HeLa/mNG-KRAS clones using Western blot is shown in Figure 2. The colonies were lysed in TGH buffer, and the lysates were electrophoresed and transferred onto nitrocellulose membrane. We detected two homozygous clones in 24 colonies screened. Load lysates from parental cell line as control for the WT untagged protein. It is essential to make sure that off target changes occurring during Cas9 mediated gene editing do not affect the cells in such a way that they are unfit for the study. Since our focus is to study EGFR-RAS-MAPK pathway, we chose the clones that exhibited similar ERK1/2 phosphorylation kinetics in HeLa parental and tagged KRAS and NRAS cells in presence of EGF (Surve et al., 2021).

Figure 2. Screening of HeLa/mNG-KRAS single cell clones. The single cell colonies were obtained either from a 10-cm plate where transfected cells were diluted or from a flow cytometer sorted population in a 96 well plate. First screening was done by checking cell fluorescence using a confocal microscope. Second screening was performed by probing lysates of parental (Par) HeLa and single-cell clones of HeLa/mNG-KRAS cells using Western blotting (WB) with KRAS antibodies to determine the zygosity of the clones expressing mNG-KRAS. Clones from 2 to 10 (in A) were obtained from 10 cm plate, whereas remaining clones were obtained via flow sorting. Clone names starting with T1 are from Target 1 gRNA, whereas those with T2 are the results of Target 2 gRNA transfection. Top arrow in A and B indicate mNG-KRAS fusion protein, whereas lower arrow indicates untagged KRAS protein. Clones with asterisk are homozygous clones as they are missing a band corresponding to the untagged native KRAS.
Examples of localization of endogenous tagged KRAS, NRAS and Grb2
After the screening and confirmation of the tagged cell lines, we imaged living tagged cell lines with spinning disc confocal microscope (Figure 3).

Figure 3. Localization of endogenous tagged KRAS, NRAS, and Grb2 with mNG in HeLa cells. Live cell imaging was performed using a spinning disc confocal microscope through 488 nm (green; mNG) channel. Single confocal sections are shown. A. mNG-KRAS localized mostly at the plasma membrane (closed arrows), and a small proportion also localized in vesicles (open arrows). B. Majority of mNG-NRAS localized at the plasma membrane. mNG-NRAS was also in the juxta-nuclear region (dotted circle) and tubular shaped structures (open arrows). C. Grb2-mNG localized to cytoplasm and nucleus.

Recipes

Cell Sorting buffer
1× PBS (Ca/Mg++ free)
2% heat-inactivated FBS
1 mM EDTA
TGH buffer
1% Triton X-100
10% glycerol
50 mM HEPES
2 mM EGTA
Phosphatase and protease inhibitors

Acknowledgments

Authors thank Drs Feng Zhang, Broad Institute, Cambridge, MA, and Janet Rossant, Peter Gilgan Centre for Research and Learning, The Hospital for Sick Children, Toronto, ON, Canada, for plasmids. This study was supported by NIH grants CA089151 and GM124186. S. Surve was also supported by the fellowship from National Cancer Center. This protocol was adapted from Surve et al. (2021).

Competing interests

The authors declare no competing financial interests.

References

Howe, C. L., Valletta, J. S., Rusnak, A. S. and Mobley, W. C. (2001). NGF signaling from clathrin-coated vesicles: evidence that signaling endosomes serve as a platform for the Ras-MAPK pathway. Neuron 32(5): 801-814.
Jiang, X. and Sorkin, A. (2002). Coordinated traffic of Grb2 and Ras during epidermal growth factor receptor endocytosis visualized in living cells. Mol Biol Cell 13(5): 1522-1535.
Karnoub, A. E. and Weinberg, R. A. (2008). Ras oncogenes: split personalities. Nat Rev Mol Cell Biol 9(7): 517-531.
Lu, A., Tebar, F., Alvarez-Moya, B., Lopez-Alcala, C., Calvo, M., Enrich, C., Agell, N., Nakamura, T., Matsuda, M. and Bachs, O. (2009). A clathrin-dependent pathway leads to KRas signaling on late endosomes en route to lysosomes. J Cell Biol 184(6): 863-879.
Pinilla-Macua, I., Grassart, A., Duvvuri, U., Watkins, S. C. and Sorkin, A. (2017). EGF receptor signaling, phosphorylation, ubiquitylation and endocytosis in tumors in vivo. Elife 6: e31993.
Pinilla-Macua, I., Watkins, S. C. and Sorkin, A. (2016). Endocytosis separates EGF receptors from endogenous fluorescently labeled HRas and diminishes receptor signaling to MAP kinases in endosomes. Proc Natl Acad Sci U S A 113(8): 2122-2127.
Pol, A., Calvo, M. and Enrich, C. (1998). Isolated endosomes from quiescent rat liver contain the signal transduction machinery. Differential distribution of activated Raf-1 and Mek in the endocytic compartment. FEBS Lett 441(1): 34-38.
Ran, F. A., Hsu, P. D., Wright, J., Agarwala, V., Scott, D. A. and Zhang, F. (2013). Genome engineering using the CRISPR-Cas9 system. Nat Protoc 8(11): 2281-2308.
Schmick, M., Vartak, N., Papke, B., Kovacevic, M., Truxius, D. C., Rossmannek, L. and Bastiaens, P. I. H. (2014). KRas localizes to the plasma membrane by spatial cycles of solubilization, trapping and vesicular transport. Cell 157(2): 459-471.
Surve, S., Watkins, S. C. and Sorkin, A. (2021). EGFR-RAS-MAPK signaling is confined to the plasma membrane and associated endorecycling protrusions. J Cell Biol 220(11).
Surve, S. V., Myers, P. J., Clayton, S. A., Watkins, S. C., Lazzara, M. J. and Sorkin, A. (2019). Localization dynamics of endogenous fluorescently labeled RAF1 in EGF-stimulated cells. Mol Biol Cell 30(4): 506-523.
von Zastrow, M. and Sorkin, A. (2021). Mechanisms for Regulating and Organizing Receptor Signaling by Endocytosis. Annu Rev Biochem 90: 709-737.