Materials and Reagents

0.1-10 μl pipet tips (Thermo Fisher Scientific, catalog number: QSP# TF104 )
1-200 μl and 100-1,000 μl pipet tips (Corning, catalog number: 4845 and 4846 , respectively)
0.2 ml 8 strips PCR tubes and caps (NIPPON Genetics, catalog number: FG-028DC )
1.5 ml and 2.0 ml microcentrifuge tubes (Corning, catalog number: MCT-150-A and MCT-200-C , respectively)
15 ml and 50 ml centrifuge tubes (Corning, catalog number: 352096 and 352070 , respectively)
96-well fast plate (NIPPON Genetics, catalog number: 38801 )
1 ml syringe (MonotaRO Co., NIPRO Genetics, catalog number: 08-010 )
Human hepatocyte-chimeric mice (PhoenixBio Co.)
Note: Chimeric mice are intravenously infected with 100 μl of HBV-C in saline solution (10⁶ copies per mouse) derived originally from patient with chronic hepatitis (Sugiyama et al., 2006).
HBV (genotype C; HBV-C) (Dr. Yasuhito Tanaka, Department of Virology and Liver Unit, Nagoya City University Graduate School of Medical Sciences, Nagoya, Japan; Sugiyama et al., 2006)
Sodium chloride (Nacalai tesque, catalog number: 31320-05 )
YSK lipid (a pH-sensitive cationic lipid) (Faculty of Pharmaceutical Sciences, Hokkaido University, Sapporo, Hokkaido, Japan) (Sato et al., 2012)
Cholesterol (Avanti Polar Lipid, catalog number: 57-88-5 )
1, 2-dimyristoyl-sn-glycerol methoxypolyethyleneglycol (PEG-DMG) (NOF Corporation, catalog number: GM-020 )
Nuclease free-H₂O
Citrate buffer (12.5 mM citrate, 500 mM NaCl)
pCpGfree-mcs vector (Invivogen)
Primers for vector construction
pLKO.1 Fw SpeI: CCCACTAGTTTTCCCATGATTCCTTCATATTT
pLKO.1 Rv BglII: CCCAGATCTAAAATTGTGGATGAATACTGCC
TaqMan Universal PCR Master Mix (Life Technologies, catalog number: 4304437 )
Note: Currently, it is “Thermo Fisher Scientific, Applied Biosystems™, catalog number: 4304437”.
Primers and probe for quantification of HBV DNA from HBV-infected chimeric mice sera:
Forward Primer: SF2: 5’-CTTCATCCTGCTGCTATGCCT-3’
Reverse Primer: SR2: 5’-AAAGCCCAGGATGATGGGAT-3’
Probe: SP2: FAM-ATGTTGCCCGTTTGTCCTCTAATTCCAG-TAMRA
MISSION^® pLKO.1-puro Empty Vector Control Plasmid DNA (Sigma-Aldrich, catalog number: SHC001 )
DNA oligo nucleotides (5’-3’)
Sense: CCGGTGTACATGTCCCACTGTTCAAGCCTCCAAGCTGTGCCTTGGGTGGCTTTGGGGCATGGACATTTTTG
Antisense:
AATTCAAAAATGTCCATGCCCCAAAGCCACCCAAGGCACAGCTTGGAGGCTTGAACAGTGGGACATGTACA
Oligo nucleotides (see Recipes)

Equipment

Biosafety hood in a biosafety level 3 (BSL3) facility (HITACHI, catalog number: SCV-1303 ECIIB )
Pipettes (PIPETMAN P2, P20 and P1000) (Gilson Scientific, catalog number: F144801 , F123600 and F123602 , respectively)
qPCR adhesive seal (NIPPON Genetics, catalog number: 4Ti-0560 )
Applied Biosystems Veriti Thermal Cycler (Life Technologies, catalog number: 4375786 )
Note: Currently, it is “Thermo Fisher Scientific, Applied Biosystems™, catalog number: 4375786”.
ABI StepOnePlusTM Real-Time PCR Systems (Life Technologies, catalog number: 4379216 )
Note: Currently, it is “Thermo Fisher Scientific, Applied Biosystems™, catalog number: 4379216”.

Procedure

εRNA-MEND preparation
1. The oligo nucleotides are annealed and inserted into an AgeI-EcoRI doubly digested pLKO.1-puro vector. With the ligated vector, the U6 promoter and εRNA-coding fragment are amplified through PCR by using a pair of primers (pLKO.1 Fw SpeI: CCCACTAGTTTTCCCATGATTCCTTCATATTT; pLKO.1 Rv BglII: CCCAGATCTAAAATTGTGGATGAATACTGCC), the PCR product is digested with SpeI and BglII and inserted into pCpGfree-mcs vector. This final construct is hereinafter called p-εRNA.
  
  Figure 1. A plasmid map of U6 promoter-driven εRNA expression vector (p-εRNA)
2. The preparation of the p-εRNA loaded in a liposome carrier is based on the procedure that was previously described (Sato et al., 2012): p-εRNA or empty pCpGfree-mcs vector is formulated into lipid nanoparticles (MEND). 80 μg of p-εRNA or empty vector (in H₂O) is dissolved in 120 μl of citrate buffer (12.5 mM citrate, 500 mM NaCl). Addition of this solution to 480 μl of the tertiary butanol containing YSK lipid (2,100 nmol), cholesterol (900 nmol), and 1, 2-dimyristoyl-sn-glycerol, methoxypolyethyleneglycol (150 nmol) leads to spontaneous formulation of liposomal particles (εRNA-MEND or control-MEND). The prepared εRNA-MEND is stocked at 4 °C until use.
Infection of human hepatocyte-chimeric mice with HBV
Note: All procedures involving the manipulation of HBV infectious materials should be conducted within biological safety cabinets (BSL3).
Chimeric mice are intravenously infected with 100 μl of HBV-C in saline solution (10⁶ copies per mouse) derived originally from patient with chronic hepatitis (Sugiyama et al., 2006). Three weeks after HBV infection, the sera are prepared by collecting blood samples from the tail vein and the efficiency of infection is confirmed by measuring the number of viral genome copies in the sera of HBV-infected chimeric mice by qPCR analysis as below:
1. Prepare HBV DNA standard sample:
  The HBV plasmid (pUC19-HBV, genotype A) is subjected to a 10-fold serial dilutions in Nuclease free-H₂O ranging from 1 x 10³ to 1 x 10⁹ copies/ml, and use 10 μl of this diluted sample (ranging from 1 x 10 to 1 x 10⁷ copies/assay) as standard to quantification of HBV DNA.
2. Set up qPCR reaction mixtures as follows (for one sample):
  DNA samples from sera of HBV-infected chimeric mice:
  
  Nuclease free-H₂O
  6 μl
  TaqMan Universal PCR Master Mix
  12.5 μl
  Probe SP2 (10 μM)
  0.5 μl
  Forward primer SF2 (10 μM)
  0.5 μl
  Reverse primer SR2 (10 μM)
  0.5 μl
  HBV DNA sample (from sera)
  5 μl
  
  25 μl
  
  Standard DNA samples:
  
  Nuclease free-H₂O
  1 μl
  TaqMan Universal PCR Master Mix
  12.5 μl
  Probe SP2 (10 μM)
  0.5 μl
  Forward primer SF2 (10 μM)
  0.5 μl
  Reverse primer SR2 (10 μM)
  0.5 μl
  Standard DNA:
  10 μl
  Total
  25 μl
  
  Note: Use 10 μl of nuclease free-H₂O instead of standard DNA as negative control. Each sample is prepared in triplicate.
3. Start the real-time PCR following the program as below:
  
  Holding stage
  95 °C
  10 min
  
  1 cycle
  Cycling stage
  95 °C
  15 sec
  
  45 cycles
  60 °C
  1 min
  Data collection
  Final holding stage
  4 °C
  ∞
In vivo treatment with εRNA
At 4-week postinfection, εRNA-MEND or control-MEND, is administered intravenously at a dose of 0.5 mg/kg of body weight (n=3 per group) every two days for 14 days. Serum and liver samples can be subjected to qPCR for the quantification of DNA copy numbers of HBV or other analyses.

Recipes

DNA oligonucleotides used for the p-εRNA plasmid construction

Sequence (5’→3’)
Sense
CCGGTGTACATGTCCCACTGTTCAAGCCTCCAAGCTGTGCCTTGGGTGGCTTTGGGGCATGGACATTTTTG
Antisense
AATTCAAAAATGTCCATGCCCCAAAGCCACCCAAGGCACAGCTTGGAGGCTTGAACAGTGGGACATGTACA

Acknowledgments

This protocol, which was adapted from Sato et al. (2015), is partially based on the earlier works by Sato et al. (2012) and Sugiyama et al. (2006). This was supported by a grant from the Ministry of Education, Culture, Sports, Science and Technology of Japan (Grant-in-Aid for Scientific Research [A] [25253030] to A.T., Grant-in-Aid for Scientific Research on Innovative Areas [25115502, 23112701] to A.T., Grant-in-Aid for Young Scientists [B] [25870015] to S.S.).

References

Bartenschlager, R. and Schaller, H. (1992). Hepadnaviral assembly is initiated by polymerase binding to the encapsidation signal in the viral RNA genome. EMBO J 11(9): 3413-3420.
Sato, S., Li, K., Kameyama, T., Hayashi, T., Ishida, Y., Murakami, S., Watanabe, T., Iijima, S., Sakurai, Y., Watashi, K., Tsutsumi, S., Sato, Y., Akita, H., Wakita, T., Rice, C. M., Harashima, H., Kohara, M., Tanaka, Y. and Takaoka, A. (2015). The RNA sensor RIG-I dually functions as an innate sensor and direct antiviral factor for hepatitis B virus. Immunity 42(1): 123-132.
Sato, Y., Hatakeyama, H., Sakurai, Y., Hyodo, M., Akita, H. and Harashima, H. (2012). A pH-sensitive cationic lipid facilitates the delivery of liposomal siRNA and gene silencing activity in vitro and in vivo. J Control Release 163(3): 267-276.
Sugiyama, M., Tanaka, Y., Kato, T., Orito, E., Ito, K., Acharya, S. K., Gish, R. G., Kramvis, A., Shimada, T., Izumi, N., Kaito, M., Miyakawa, Y. and Mizokami, M. (2006). Influence of hepatitis B virus genotypes on the intra- and extracellular expression of viral DNA and antigens. Hepatology 44(4): 915-924.