Cells were treated with 500 nM GrK or 500 nM GrKSA. After 16 hours, 1 ml of TRIzol Reagent (Ambion) was added to homogenize the sample. After 5 minutes at room temperature, the RNA was extracted using chloroform. The RNA-phase was precipitated with isopropanol, pelleted by centrifugation at 10,000 rpm for 15 minutes, washed with 70% ethanol and dissolved in water. Subsequently, an equal amount of RNA was used to make cDNA. RNA expression levels were measured in a RT-qPCR reaction, using SYBR Green Dye (Applied Biosystems). All measurements were performed in duplicate on a ViiA 7 Real-Time PCR System (Applied Biosystems). Relative quantification results were obtained using the ΔΔCt method and expression values were normalized to ubiquitin C (UBC). Primers used in 5’ to 3’ direction: sVEGFR1 forward:AGAGGTGAGCACTGCAACAA, sVEGFR1 reverse: TCTCCTCCGAGCCTGAAAGT, UBC forward: AGTAGTCCCTTCTCGGCGAT and UBC reverse: GCATTGTCAAGTGACGATCACAG.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.