WT and cavin3 KO cells lacking CHD3, FANCD2, PARP1, and TP53BP1 were generated using the Alt-R CRISPR-Cas9 system (Integrated DNA Technologies). The following predesigned Alt-R CRISPR-Cas9 gRNAs were used:

Hs.Cas9.CHD3.1.AA, strand sequence GACCGGGTCGGAAACGAAGA

Hs.Cas9.FANCD2.1.AA, strand sequence AGTTGACTGACAATGAGTCG

Hs.Cas9.PARP1.1.AA, strand sequence GAGTCGAGTACGCCAAGAGC

Hs.Cas9.TP53BP1.1.AA strand sequence AACGAGGAGACGGTAATAGT

Each RNA oligo (Alt-R CRISPR Cas9 cRNA, tracrRNA) was resuspended in Nuclease-Free IDTE Buffer. The crRNA and tracrRNA were mixed in equimolar concentrations, heated at 95°C for 5 min, followed by cooling to RT. To produce the RNP complex for each well of a 96-well plate, the following was combined: 1.5 μl of 1 μM Guide RNA oligos, 1.5 μl of 1 μM diluted Cas9 enzyme with 0.6 μl of Cas9 PLUS Reagent from Lipofectamine CRISPRMAX kit and 21.4 μl of Opti-MEM Media followed by incubation at RT for 5 min to assemble the RNP complexes. The RNP was further mixed with 1.2 μl of CRISPRMAX transfection reagent in Opti-MEM for a further 20 min to form the transfection complexes. This was then added to 40,000 HeLa WT or cavin3 KO cells/ml that were seeded in a well of a 96-well tissue culture plate. The plates containing the transfection complexes and cells were returned to a tissue culture incubator for 72 hr. These cells were then subjected to single-cell plating for clonal selection. Loss of each of the proteins was verified by western blot analysis of cell lysates using the following antibodies: CHD3 (GeneTex, Cat# GTX131779, RRID:AB_2886520, WB: 1:500), FANCD2 (GeneTex, Cat# GTX116037, RRID:AB_2036898, WB: 1:500), PARP1 (GeneTex, Cat# GTX112864, RRID:AB_11173565, WB: 1:1000), and 53BP1 (GeneTex, Cat# GTX70310, WB 1:1000).

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.