Mice were sacrificed by decapitation following quick anesthesia by isoflurane. Brains were removed, snap-frozen in isopentane at −40°C, and stored at −80°C. Frozen brains were sectioned at −20°C in a cryostat microtome at 18 μm, thaw mounted on Super Frost Plus slides, dried and stored at −80°C. In situ hybridization using 35S UTP labeled ribonucleotide probes (Fkbp5, Nr3c1 and Nr3c2) was performed as described previously (Schmidt et al., 2007). The slides were exposed to Kodak Biomax MR films (Eastman Kodak Co., Rochester, NY) and developed. Autoradiographs were digitized, and expression (i.e., signal intensity in arbitrary units) was determined by optical densitometry utilizing the freely available NIH ImageJ software. Each region of interest (left and right hemisphere) was manually outlined. The mean of two measurements of one brain slice was calculated for each animal. The data were analyzed blindly, always subtracting the background signal of a nearby structure not expressing the gene of interest from the measurements.

RNAscope technology provides a more precise method for multiplex fluorescent cellular level in situ hybridization. Mice were sacrificed by decapitation following quick anesthesia by isoflurane. Brains were removed, snap-frozen in isopentane at −40°C, and stored at −80°C. Frozen brains were sectioned in the coronal plane at −20°C in a cryostat microtome at 18 μm, mounted on Super Frost Plus slides, and stored at −80°C. The RNA Scope Fluorescent Multiplex Reagent kit (cat. no. 320850, Advanced Cell Diagnostics, Newark, CA, USA) was used for mRNA staining. Probes used for staining were: mm-Nr3c1-C1, mm-Fkbp5-C2 and mm-Nr3c2-C3. The staining procedure was performed according to manufacturer’s specifications as described previously (McCullough et al., 2018). Briefly, sections were fixed in 4% paraformaldehyde for 15 min at 4°C. Subsequently, brain sections were dehydrated in increasing concentrations of ethanol. Next, tissue sections were incubated with protease IV for 30 min at room temperature. Probes were hybridized for 2 h at 40°C followed by 4 hybridization steps of the amplification reagents 1 to 4. Next, sections were counterstained with DAPI (4′,6-diamidino-2-phenylindole), coverslipped and stored at 4°C until image acquisition. Sixteen-bit images of the dorsal hippocampus were acquired on a Leica SP8 confocal microscope using a 40x objective (n = 4 mice). For every individual marker, all images were acquired using identical settings for laser power, detector gain, and amplifier offset.

Mice were deeply anesthetized with isoflurane and perfused intracardially with 4% paraformaldehyde. Brains were removed, post-fixed overnight in 4% paraformaldehyde following overnight incubation in 30% sucrose solution at 4°C, and then stored at −80°C. Frozen brains were coronally sectioned in a cryostat microtome at 35 μm. Triple-immunofluorescence was performed on free-floating sections as described previously (Hartmann et al., 2017). Sections were incubated with primary antibodies (goat anti-FKBP5 (F-14, Santa Cruz, 1:500), rabbit anti-GR (M-20, Santa Cruz, 1:1000) and mouse anti-MR (MABS496, clone 6G1, Millipore-Sigma, 1:100)) overnight at 4°C and labeled with AlexaFluor-conjugated secondary antibodies (1:1000)). Sections were mounted on Super Frost Plus slides and covered with Vectashield mounting medium (Vector Laboratories, Burlingame, USA) containing DAPI. Sixteen-bit images of the dorsal hippocampus were acquired on a Leica SP8 confocal microscope using 10x or 63x objectives (n = 5 mice). For every individual marker, all images were acquired using identical settings for laser power, detector gain, and amplifier offset.

Mice were restrained in a 50 mL falcon tube. Each tube had 2 holes drilled into the bottom, as well as in the lid to allow the animals to breathe normally and move their tail. After 4 h, animals were removed from the tube, deeply anesthetized with isoflurane and sacrificed by decapitation. Control animals were kept undisturbed in their home cage until sacrifice. Trunk blood was collected in labeled 1.5 mL EDTA-coated microcentrifuge tubes (Sarstedt, Germany) and kept on ice until centrifugation. After centrifugation (4°C, 8000 rpm for 15 min) plasma was removed and transferred to new, labeled tubes and stored at −20°C until corticosterone quantification. For mRNA analysis, brains were removed, snap-frozen in isopentane at −40°C, and stored at −80°C for in situ hybridization.

Corticosterone (CORT) concentrations were determined by radioimmunoassay using a Corticosterone double antibody 125I RIA kit (sensitivity: 12.5 ng/ml, MP Biomedicals Inc) and were used according to the manufacturers’ instructions. Radioactivity of the pellet was measured with a gamma counter (Packard Cobra II Auto Gamma; Perkin-Elmer). Final CORT levels were derived from the standard curve.

Male C57BL/6J mice were administered dexamethasone (Dex, Sigma, St Louis, MO, USA, catalog no. D1159) intraperitoneally (i.p.) at a dose of 10 mg/kg dissolved in saline. The injection volume was 10 μl/g body weight. Vehicle treated mice were injected with the same amount of saline. Injections were performed between 08:00 am and 09:00 am. 4 h after the injection, all mice were sacrificed by decapitation following quick anesthesia by isoflurane. Brains were removed, snap-frozen in isopentane at −40°C, and stored at −80°C until further processing.

Male C57BL/6J mice were single housed 4 days prior to the experiment and their daily water intake was monitored. On the experimental day, mice were treated overnight (14 h) with either CORT (0.1 mg/ml in drinking water resulting in a ~25 mg/kg average dose based on the initially determined fluid intake; 4-pregnen-11β 21-DIOL-3 20-DIONE 21-hemisuccinate, #Q1562-000, Steraloids), RU486 (0.05 mg/ml in 0.5% EtOH resulting in a ~10 mg/kg average dose based on the initially determined fluid intake; Mifepristone, #475838, Sigma-Aldrich) or Spironolactone (0.124 mg/ml in 0.4% EtOH resulting in a ~20 mg/kg average dose based on the initially determined fluid intake; #S3378, Sigma-Aldrich). Control animals received their respective vehicle solutions. The next morning all mice were sacrificed by decapitation following quick anesthesia by isoflurane. Brains were removed, snap-frozen in isopentane at −40°C, and stored at −80°C until further processing. Overnight fluid intake did not differ between treatment groups.

Tissue punches of the dorsal hippocampus were collected, total RNA was isolated and purified using the Quick-RNA Miniprep kit (Zymo research, Irvine, CA, USA, catalog no. R1054) according to the manufacturer’s protocol. RNA templates were reverse transcribed into cDNA with the Superscript IV kit (Thermo Scientific, Waltham, MA, USA, catalog no. 18091200) and random hexamer primers. cDNA was amplified on an Applied Biosystems ViiA7 Real-Time PCR System with POWRUP SYBR Green Master Mix (Thermo Scientific, Waltham, MA, USA, catalog no. 4368706). Primer sequences for Fkbp5, Nr3c1, Nr3c2 and Gapdh (housekeeper) can be found in the key resources table. Ct values were normalized using the established delta-delta Ct method (2–ΔΔCt) and normalized to Gapdh Cts.

KEY RESOURCES TABLE

OligoIP was performed in mouse primary hippocampal neurons using a previously established method (Ibrahim et al., 2013) (schematically outlined in Figure 3A). In short, single-stranded complementary biotinylated-oligonucleotide probes (length 70 bp) spanning part of Fkbp5’s promotor region including two GREs (underlined) (5′ GACTTGGTGAGAGAAAAACAGTCCCTAAGAATGGCGCCAAG CATAAATATCTGTTGAATCAAAAATCAAG 3′, Integrated DNA technologies (IDT), Leuven, Belgium) were annealed. Subsequently, 0.5 pmol/106 cells of probes were transfected into neuronal cells (3–3,5 × 106 cells per replicate). After 24 h, the cells were incubated for 24 hours at 37°C with either vehicle (DMSO) or dexamethasone (1.5 nM, 15 nM and 150 nM in Figures 3B3E; 15nM in Figures 4K4O). For HA-GR or HA-MR overexpression (pRK7-HA-GR, pRK7-HA-MR, pRK7 empty vector as CTRL (Schülke et al., 2010) or MR knockdown (Nr3c2-siRNA 5′ GTGAAGTGGGCCAAGGTACTTCCAGGATTTAAAAACTTGCC 3′, IDT, Leuven, Belgium) experiments cells were transfected in parallel to oligonucleotide probes. In this case cells were harvested 48 h after transfection. Subsequently cells were cross-linked with 1% formaldehyde/ PBS at room temperature for 15 min and were lysed in RIPA buffer (Merck, 20-188, completed with protease inhibitor cocktail, Sigma, 04693132001). Lysates were precipitated using streptavidin-coupled magnetic beads (Dynabeads M-280, Thermo Scientific, 11205D) or control beads lacking conjugated streptavidin (Protein G Dynabeads, Thermo Scientific, 10007D), and both input and eluates were quantified for MR and GR by western blotting.

Protein extracts were obtained by lysing cells in RIPA buffer (Merck, 20-188, completed with protease inhibitor cocktail, Sigma, 04693132001). Proteins were separated by SDS-PAGE and electro-transferred onto PVDF membranes. Western Blots were placed for blocking in Tris-buffered saline (TBST; 50 mM Tris-Cl, pH 7.6; 150 mM NaCl, 0.05% Tween 20) and 5% non-fat milk for 1 h at room temperature and subsequently incubated with primary antibody TBST overnight at 4°C. The following primary antibodies were used: FKBP5/FKBP51 (1:1,000, Bethyl, A301-430A), MR (1:800, Santa Cruz, N-17), GR (1:800, Cell Signal, #12041), FLAG (1:5,000, Sigma, F3165), HA (1:8,000, 11867423001) and Actin (1:5,000, Santa Cruz, I-19). Subsequently, the blots were washed with TBST and probed with the respective horseradish-peroxidase or fluorophore-conjugated secondary antibody for 2 h at room temperature.

The immuno-reactive bands were detected either by using ECL detection reagent (Millipore, WBKL0500) or directly by excitation of the respective fluorophore. Recording of the band intensities was performed with the ChemiDoc MP from Bio-Rad. Protein data were normalized to Actin, which was detected on the same blot in the same lane (multiplexing).

Mouse hippocampus single-cell RNA sequencing data were publicly available from the McCarroll Lab (Department of Genetics, Harvard Medical School) (Saunders et al., 2018). t-distributed stochastic neighbor embedding (t-SNE) plots for hippocampus global clustering of cell-types, as well as for Fkbp5, Nr3c1 and Nr3c2 expression profiles were generated using the Seurat 3.0 package in R (Stuart et al., 2019). The cluster-specific number of Fkpb5, Nr3c1 and Nr3c2 expressing cells were extracted for further analysis.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.