OligoIP was performed in mouse primary hippocampal neurons using a previously established method (Ibrahim et al., 2013) (schematically outlined in Figure 3A). In short, single-stranded complementary biotinylated-oligonucleotide probes (length 70 bp) spanning part of Fkbp5’s promotor region including two GREs (underlined) (5′ GACTTGGTGAGAGAAAAACAGTCCCTAAGAATGGCGCCAAG CATAAATATCTGTTGAATCAAAAATCAAG 3′, Integrated DNA technologies (IDT), Leuven, Belgium) were annealed. Subsequently, 0.5 pmol/106 cells of probes were transfected into neuronal cells (3–3,5 × 106 cells per replicate). After 24 h, the cells were incubated for 24 hours at 37°C with either vehicle (DMSO) or dexamethasone (1.5 nM, 15 nM and 150 nM in Figures 3B3E; 15nM in Figures 4K4O). For HA-GR or HA-MR overexpression (pRK7-HA-GR, pRK7-HA-MR, pRK7 empty vector as CTRL (Schülke et al., 2010) or MR knockdown (Nr3c2-siRNA 5′ GTGAAGTGGGCCAAGGTACTTCCAGGATTTAAAAACTTGCC 3′, IDT, Leuven, Belgium) experiments cells were transfected in parallel to oligonucleotide probes. In this case cells were harvested 48 h after transfection. Subsequently cells were cross-linked with 1% formaldehyde/ PBS at room temperature for 15 min and were lysed in RIPA buffer (Merck, 20-188, completed with protease inhibitor cocktail, Sigma, 04693132001). Lysates were precipitated using streptavidin-coupled magnetic beads (Dynabeads M-280, Thermo Scientific, 11205D) or control beads lacking conjugated streptavidin (Protein G Dynabeads, Thermo Scientific, 10007D), and both input and eluates were quantified for MR and GR by western blotting.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.