Tissues from each rat at day 14 were homogenized in an ultrasonic probe. RNA was extracted utilizing a nucleic acid extraction kit (NucleoSpin®, Macherey-Nagel GmbH & Co. KG, Duerin, Germany). The purity estimated as (A260/A280 ratio) and RNA concentration were obtained using spectrophotometry (dual-wavelength Shimadzu, Spectrophotometer, Japan). In order to construct a cDNA library, reverse transcription was performed using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). Then, PCR amplification was completed using a Taq PCR Master Mix Kit (Qiagen, Valencia, CA, USA) using the Col1A1 (NM_053304.1) primer as well as GPADH (NM_017008.4) as a housekeeping gene. Forward/reverse nucleotide sequences of Col1A1 and GAPDH were ATCAGCCCAAACCCCAAGGAGA/CGCAGGAAGGTCAGCTGGATAG and CCATTCTTCCACCTTTGATGCT/TGTTGCTGTAGCCATATTCATTGT, respectively. After the RT-PCR run, the data were expressed in cycle threshold (Ct). The relative quantitation (RQ) of Col1A1 to GAPDH was determined according to the calculation of delta-delta Ct (ΔΔCt).

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.