Total RNA was extracted from cells using TRIzol (Invitrogen, Carlsbad, CA, USA) according to provided instructions. RNA concentration and purity were measured in triplicates utilizing the NanoDrop 2000 spectrophotometer (Thermo Scientific Inc., Waltham, MA, 93 USA). Then, total RNA was reverse transcribed to cDNA using the cDNA Reverse Transcription Kit (Vazyme, Nanjing, China). qRT-PCR analyses were performed using SYBR® Premix Ex Taq™ II (Takara, Dalian, China) and Taqman UniversalMaster Mix II (Life Technologies Corporation, Carlsbad, CA, United States) on Applied Biosystems 7500/7500 Fast Real-Time PCR System (Thermo Fisher Scientific). The 2-ΔΔCt method was used to calculate the relative mRNA expression normalized by GAPDH and HTRA3. The sequences of primers used for PCR were as follows: HTRA3, 5′- AAGAAGTCGGACATTGCCACCATC -3′ (forward) and 5′- CCGTTGTCACTGTGTTCTGTAGGG -3′ (reverse); and GAPDH, 5′-GGAGCGAGATCCCTCCAAAAT-3′ (forward) and 5′- GGCTGTTGTCATACTTCTCATGG-3′ (reverse).

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.