RNA was extracted from mouse colon and spleen macrophages using respectively TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and Direct-zol™ RNA MiniPrep w/Zymo-Spin™ IIC Columns (Zymo Research, Irvine, CA, USA). 1 μg of RNA from each sample was reverse transcribed using FastGene Scriptase Basic Kit (Nippon Genetics Europe, Düren, GE) in a 20-μL reaction volume; 50 ng of cDNA was amplified in a 20-μL solution containing 200 nM of each primer and 10 μL of SYBR Select Master Mix (Thermo Fisher Scientific, Waltham, MA, USA). All reactions were performed in triplicate using the following thermal cycling conditions: 3 min at 95 °C, followed by 40 cycles of 95 °C for 15 s, 56 °C for 20 s, and 72 °C for 30 s, using a StepOnePlus system (Applied Biosystems, Foster City, CA, USA). The relative mRNA expression was calculated according to the ΔCt method. Primers were designed using the software PRIMER3 (http://frodo.wi.mit.edu/primer3/), using data published in the NCBI database. The primer used were as following (forward and reverse): mGapdh (for CTGAGTATGTCGTGGAGTCTAC; rev GTTGGTGGTGCAGGATGCATTG), mTnfα (for CCACCACGCTCTTCTGTCTA; rev AGGGTCTGGGCCATAGAACT), mIl-6 (for CTTCACAAGTCGGAGGCTTA; rev TTCTGCAAGTGCATCATCGT), mTgfβ (for TTGCTTCAGCTCCACAGAGA; rev TGGTTGTAGAGGGCAAGGAC), mAce2 (for AGATGGCCGGAAAGTTGTCT; rev GGGCTGTCAAGAAGTTGTCC), mMas (for CTGCTGACAGCCATCAGTGT; rev ACAGAAGGGCACAGACGAAT), mIl1β (for GCTGAAAGCTCTCCACCTCA; rev AGGCCACAGGTATTTTGTCG), Cyp1a1 (for ACTCTTCCCTGGATGCCTTC; rev GTCTGTGATGTCCCGGATGT) (Thermo Fisher Scientific, Waltham, MA, USA).

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.