Ba/F3 murine bone marrow-derived pro-B cells (purchased from RIKEN BRC) harboring EGFR mutations were cultured in low-glucose Dulbecco’s modified Eagle’s medium (DMEM; Wako) containing 10% fetal bovine serum (FBS), kanamycin, and 0.5 ng/mL of interleukin-3 (IL-3). 293FT human embryonic kidney cells (purchased from Invitrogen) were cultured in high-glucose DMEM supplemented with 10% FBS and kanamycin (Meiji Seika Pharma). EGFR-L747P, del19, L858R, del19/T790M, and L858R/T790M mutant Ba/F3 cells were generated by lentiviral infection produced by a pLenti6.3-EGFR-L747P del19, L858R, del19/T790M, or L858R/T790M plasmid and packaging plasmids as indicated below. All cells were regularly tested to ensure that they were free of mycoplasma contamination.

Primers

Mutagenesis primer for creating EGFR-L747P

- EGFR-L747P-F: CGTCGCTATCAAGGAACCAAGAGAAGCAACATCTCC

- EGFR-L747P-R: GGAGATGTTGCTTCTCTTGGTTCCTTGATAGCGACG

Sequencing primers for EGFR

- EGFR ORF F1: GTGGCGGGACATAGTCAGCAGTG

- EGFR ORF F2: CCTCAGGCCATGAACATCACCTG

- EGFR ORF F3: CCGTGAGTTGATCATCGAATTC

- EGFR ORF R1: GAATTTGCGGCAGACCAGGCAG

- EGFR ORF R2: CTTCCGAACGATGTGGCGCCTTC

- EGFR ORF R3: CAGCTTTGCAGCCCATTTCTATC

Sequencing primers for EGFR exon19

- hEGFR-Ex19-F: GGCAGCATGTGGCACCATC

- hEGFR-Ex19-R: GCCTGAGGTTCAGAGCCATG

- hEGFR-Ex19-Fseq: GATCCCAGAAGGTGAGAAAG

- hEGFR-Ex19-Rseq: GAGGATTTCCTTGTTGGC.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.