Total RNA was extracted according to conventional protocols using TRIzol (Invitrogen, USA). cDNA was synthesized with a PrimeScript™ RT Reagent Kit (Takara, China). qPCR was carried out using TB Green® Premix Ex Taq™ II (Takara, China). mRNA expression levels were normalized to GAPDH expression levels. The primers used were as follows: TFRC, F: GCTCGGCAAGTAGATGGCGATAAC; R: ATTGTCAATGTCCCAAACGTCACC. SLC7A11, F: AGCCTGTTGTGTCCACCATCTCC; R: GTCAGAGTGATGACGAAGCCAATC. GAPDH, F: ATCATCCCTGCCTCTACTGG; R: GTCAGGTCCACCACTGACAC.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.