For the generation of clec-4(ya1) the dpy-10 co-conversion method [19, 20] was applied. To create a deletion in the clec-4 locus two double-stranded breaks were introduced by Cas9 and two crRNAs that correspond to the clec-4 target sites AATCCACTAGTGCAGACTGG and GACAAGCATCTTGTTCCCGG. The repair template carrying 35 nt homology arms for clec-4 and the gfp sequence was amplified from Fire vector pPD95.75 (5’-actgctcacaatcagtgaagcatcttatccaccaAGCTTGCATGCCTGCAGGTCGACT-3’ and 5’-tttgtctgtcttaaaagtgacaagcatcttgttccGGAAACAGTTATGTTTGGTATATTGGG-3’, with capital letters being the overlap to pPD95.75). The generated strain MY1116 clec-4(ya1), carries a 2071 bp deletion in the clec-4 ORF (sequence available upon request).

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.