The total RNA in each sample was separated by using a mirVana kit (Ambion, Hercules, CA). The quality and concentration of separated total RNA samples was evaluated by NanoDrop ND‐3000. The isolated total RNA, including circRNAs and miRNAs, in each sample was subject to reverse transcription done by utilizing a miRCURY qPCR assay kit (Exiqon, Vedbaek, Denmark) to generate corresponding cDNA templates. Then, to determine the relative expression of circRNA‐0068481 (Forward: 5’‐TATCTGCCCAAGGAGAGCAT‐3’; Reverse 5’‐TATTATCCATGGGAGGGAAGGT‐3’), miR‐646 (Forward: 5’‐AGCAGCTGCCTCTGAG‐3’; Reverse: 5’‐ GAACATGTCTGCGTATCTC‐3’), miR‐570 (Forward: 5’‐ GAAAACAGCAATTACCTTTG‐3’; Reverse: 5’‐ GAACATGTCTGCGTATCTC‐3’), miR‐885 (Forward: 5’‐ CCATTACACTACCCTGC‐3’; Reverse: 5’‐ GAACATGTCTGCGTATCTC‐3’) and EYA3 mRNA (Forward: 5’‐ GCAGTAGCCAGCATCTCAAACC‐3’; Reverse: 5’‐ GTCTGACCTGTGACTCCAAAGC‐3’) in each sample, qPCR was done with SYBR Green master mix in conjunction with specific primers and probes designed by Exiqon (Vedbaek, Denmark) on a 7500 qPCR machine (Applied Biosystems, Foster City, CA) to determine the relative expression of circRNA‐0068481, miR‐646, miR‐570, miR‐885 and EYA3 mRNA by utilizing the 2‐ΔΔCT approach. 25

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.