2.5. Reverse transcription‐polymerase chain reaction (RT‐PCR)

Total RNA was extracted using mRNA isolation kit according to the manufacturer's instructions (Takara). In RT‐PCR, an RNA population was converted into cDNA by reverse transcription (RT), and then, the cDNA was amplified by PCR. The sequences of the primers used were as follows: runt‐related transcription factor 2 (Runx2) (mice), CCAGGCAGGTGCTTCAGAACTG (forward), GGTAGTGAGTGGTGGCGGACAT (reverse); osteocalcin (OCN) (mice), GCTACCTTGGAGCCTCAGTC (forward), ATGCGTTTGTAGGCGGTCTT (reverse); Runx2 (human), CCCAGGCAGTTCCCAAGCATTT(forward), GGTAGTGAGTGGTGGCGGACAT (reverse); OCN (human), GGCAGCGAGGTAGTGAAGAGAC (forward), GGTCAGCCAACTCGTCACAGTC (reverse); bone morphogenetic protein‐2 (BMP‐2) (human), GGTCCTGAGCGAGTTCGAGTTG (forward), TGACCTGAGTGCCTGCGATACA (reverse). Quantitative RT‐PCR (RT‐qPCR) was performed with SYBR green fluorescence (Bio‐Rad Laboratories Inc). β‐actin, a housekeeping gene, was used for internal normalization. Gene expressions were analysed using the 2–ΔΔCt method.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.