TRIzol (Invitrogen) was used for total RNA isolation. Total DNAs were synthesized by conducting the PrimeScript RT reagent Kit (Takara Bio). Real‐time PCR was performed by using Real Master Mix (SYBR Green). RNase R (Epicentre) was used to digest RNAs, remove the liner RNAs and enrich the circular configuration. The primers used in this study are as follows: circCAMSAP1 forward: GTGTCAAGCGCTTCTCAACG, reverse: GCTGGACAGGAGAAGCTTGA; miR‐1294 forward: TGTGAGGTTGGCATTGTTGTCTGT, reverse: GTGCAGGGTCCGAGGTATTC; GRAMD1A forward: ACACAATGGGCTACTGTGAGG, reverse: GGCTTGGTCTCGATGCTACT; and GAPDH forward: CGCTCTCTGCTCCTCCTGTTC, reverse: ATCCGTTGACTCCGACCTTCAC. 2−ΔΔCt method was used to calculate the relative expression levels of miR‐1294 and GRAMD1. Experiment was repeated three times.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.