Also in the Article



The GeCKOx and GeCKOxs sgRNA libraries were cloned into the lentiGuide-puro sgRNA expression plasmid (Addgene 52963, [92]). The vector was digested with BsmBI (NEB) overnight at 37 °C and gel-purified. sgRNA sequences were synthesized by CustomArray flanked with OligoL (TGGAAAGGACGAAACACCG) and OligoR (GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC) sequences. For the amplification of the library, 8 or 5 (GeCKOx/GeCKOxs) PCR reactions (Primer sequences in Additional file 9: Table S8, OG113/OG114) with approx. 5 ng of the synthesized oligo pool were carried out using the Phusion Hot Start Flex DNA Polymerase (NEB), with a total of 14 cycles and an annealing temperature of 63 °C in the first 3 cycles and 72 °C in the subsequent 11 cycles. The amplicons were subsequently gel-purified.

Amplified sgRNAs were ligated into the vector through Gibson assembly (NEB). Two 20 μl Gibson reactions were carried out using 7 ng of the gel-purified insert and 100 ng of the vector. The reactions were pooled, EtOH-precipitated to remove excess salts which might impair bacterial transformation, and resuspended in 12.5 μl H2O. Nine microliters of the eluted DNA was transformed into 20 μl of electrocompetent cells (MegaX DH10B, Thermo Fisher Scientific) according to the manufacturer’s protocol using the ECM 399 electroporator (BTX). After a short incubation period (1 h, 37 °C 250 rpm) in 1 ml SOC medium, 9 ml of LB medium with Ampicillin (0.1 mg/ml, Sigma) was added to the mixture and dilutions were plated in agar plates (1:100, 1:1000, and 1:10,000) to determine the coverage of the sgRNA libraries (600x for the GeCKOx and 2500x for the GeCKOxs). In total, 500 ml of LB media with Ampicillin was inoculated with the rest of the mixture and incubated overnight for subsequent plasmid purification using the NucleoBond Xtra Maxi Plus kit (Macherey-Nagel) following the manufacturer’s instructions. To assess library composition by deep sequencing, a PCR reaction was carried out to add Illumina adaptors by using the Phusion High Fidelity DNA Polymerase (NEB), with an annealing temperature of 60 °C and 14 cycles (OG125/OG126). The PCR amplicon was gel-purified by using the Nucleospin Gel and PCR clean-up kit (Macherey-Nagel) following the manufacturer’s instructions. Libraries were sequenced paired-end 50 bp on the HiSeq 2500 Platform yielding approximately 25 Mio fragments for the GeCKOx (20 pM loading concentration) and 1.3 × 106 fragments for the GeCKOxs library (22 pM loading concentration).

Note: The content above has been extracted from a research article, so it may not display correctly.



Also in the Article

Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.