MiRNAs were assayed by quantitative real-time PCR (qRT-PCR) in plasma and PBMCs with the miRCURY LNA RT Kit (QIAGEN, Hilden, Germany). 10 ng RNA was reverse transcribed, the resulting cDNA was diluted 100× and assayed in 10 μl PCR reactions in accordance with the protocol for miRCURY LNA miRNA PCR. Each miRNA was assayed once by qPCR on the miRNA Ready-to-Use PCR, Pick and Mix using miRCURY LNA SYBR Green master mix. Negative controls from the reverse transcription reaction were performed and profiled similarly to the samples. The amplification was performed in a LightCycler® 480 Real-Time PCR System (Roche, Basel, Switzerland). has-miR-126-3p (Cat number: YP00204227) and hsa-miR-126-5p (Cat number: YP00206010) were assayed using miRCURY LNA miRNA PCR Assays (Qiagen). Normalization was performed based on the average of the assays detected in all plasma samples using global mean normalization method.

For the present study, this included 7 assays:

hsa-miR-21-5p (TAGCTTATCAGACTGATGTTGA),

hsa-miR-320a (AAAAGCTGGGTTGAGAGGGCGA),

hsa-miR-23a-3p (ATCACATTGCCAGGGATTTCC),

has-miR-92a-3p (TATTGCACTTGTCCCGGCCTGT),

hsa-miR-223-3p (TGTCAGTTTGTCAAATACCCCA),

hsa-miR-126-3p (TCGTACCGTGAGTAATAATGCG),

hsa-miR-15a-5p (TAGCAGCACATAATGGTTTGTG).

Whereas, miRNAs from PBMCs were normalized to the average of 11 assays (hsa-miR-30e-3p, Cat number: YP00204410; hsa-miR-365a-3p, Cat number: YP00204622; hsa-miR-374b-5p, Cat number: YP00204608; hsa-miR-26b-3p, Cat number: YP00204117; hsa-miR-576-5p, Cat number: YP00206064; hsa-miR-425-3p, Cat number: YP00204038; hsa-miR-454-5p, Cat number: YP00204279; hsa-miR-769-5p, Cat number: YP00204270; hsa-miR-200c-3p, Cat number: YP00204482; hsa-miR-660-5p, Cat number: YP00205911; hsa-miR-331-3p, Cat number: YP00206046; Qiagen) detected in all samples.

Amplification curves were analysed with the Roche LC software to determine ΔCt values. ΔΔCt values were calculated with the Eq. 1 and fold change calculated with Eq. 2.

Reverse transcription of 150 ng PBMC mRNAs was performed using QIAGEN RT 2 First Strand Kit (QIAGEN, Hilden, Germany), then cDNA was assayed using RT2 Profiler™ Custom Human PCR Array (QIAGEN, Hilden, Germany) containing CXCR1 (Cat number: PPH01040F) and CXCR2 (Cat number: PPH00608F). All Cq data was normalised to reference genes: actin-β (Cat number PPH00073G), lactate dehydrogenase A (Cat number: PPH02047H), hypoxanthine phosphoribosyltransferase 1 (Cat number: PPH01018C), ribosomal protein, large, P0 (Cat number: PPH21138F), β-2-microglobulin (Cat number: PPH01094E), and glyceraldehyde-3-phosphate dehydrogenase (Cat number: PPH00150F) yielding ΔCq. The gene expression fold change was calculated by the 2ΔΔCt method in Eqs. 1 and 2.

Ingenuity pathway analysis (IPA) software version 9 (Ingenuity, Redwood City, CA, USA) supported the determination of cellular functions, pathways and genes regulated by miR-126-3p/-5p. IPA generated both direct and indirect causations between different targets and analysed whether these effects would be inhibitory or stimulatory based on the published evidence.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.