The levels of iNOS, TNF-α, Arg-1, and TGF-β mRNA in each group were determined by real-time PCR as previously described [17]. Total RNA in ischemic brain tissue was removed utilizing Trizol reagent (Vazyme Biotech Co., Ltd., China). As per manufacturer's guidelines, RNA was reverse-transcribed into cDNA utilizing HiScript II Q RT SuperMix kit; real-time PCR was conducted through ChamQ SYBR qPCR Master Mix kit in quantitative PCR Mastercycler (Eppendorf, Germany). The two kits mentioned above were purchased from Vazyme Biotech Co., Ltd. (China). The primer sequences (Sangon Biotech Co., Ltd., China) were as follows:

iNOS: F: AATGGCAACATCAGGTGGCCATCACT, R: GCTGTGTGTCACAGAAGTCTCGAACTC;

TNF-α: F: GCACCACCATCAAGGACTCA, R: TCGAGGCTCCAGTGAATTCG;

Arg-1: F: GAACACGGCAGTGGCTTTAAC, R: TGCTTAGTTCTGTCTGCTTTGC;

TGF-β: F: TGGCTGAACCAAGGAGACG, R: GCAGTGAGCGCTGAATCGA;

β-Actin: F: CATCCGTAAAGACCTTTGCCAAC, R: ATGGTGCCACCGATCCACA.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.