Perihematomal brain tissues were harvested from each group at 3 days following surgery. Total RNA was extracted using Trizol Reagents (Invitrogen, Carlsbad, CA, USA) and verified by the spectrophotometric analysis (OD260/280). Primers used in the current study were synthesized commercially by Sangon Co. Ltd. (Shanghai, China) as follows: NLRP3: AGCCTTCCAGGATCCTCTTC (forward), CTTGGGCAGCAGTTTCTTTC (reverse); ASC: CTTAGAGACATGGGCTTACAGG (forward), CTCCAGGTCCATCACCAAGTAG (reverse); caspase-1: ACACGTCTTGCCCTCATTATCT (forward), TTTCACCTCTTTCACCATCTCC (reverse); IL-1β: TCATTGTGGCTGTGGAGAAG (forward), AGGCCACAGGTATTTTGTCG (reverse); IL-18: AAGAACAAGATCATTTCCTTTGAGGA (forward), GGAACACGTTTCTGAAAGAATATGAG (reverse); interleukin-6 (IL-6): AGTCCGGAGAGGAGACTTCA (forward), ATTTCCACGATTTCCCAGAG (reverse); monocyte chemotactic protein 1 (MCP-1): AGGTCCCTGTCATGCTTCTGG (forward), TGGTGATCCTCTTGTAGCTCTCC (reverse); tumor necrosis factor-α (TNF-α): CCCTCACACTCAGATCATCTTCT (forward), GCTACGACGTGGGCTACAG (reverse); and β-actin: GTGACGTTGACATCCGTAAAGA (forward), GCCGGACTCATCGTACTCC (reverse). The reverse transcription and subsequent RT-PCR analysis were performed with a Prime Script RT reagent kit and a SYBR Green kit (both from TaKaRa, Otsu, Japan), respectively. The SDS software (Applied Biosystems, Carlsbad, CA, USA) was employed to calculate the results by the ΔCt method.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.