Tissues were weighed and homogenized with zirconia beads in a MagNA Lyser instrument (Roche Life Science) in 1000 μL of DMEM supplemented to contain 2% heat-inactivated FBS. Tissue homogenates were clarified by centrifugation at 10,000 rpm for 5 min and stored at −80°C. RNA was extracted using the MagMax mirVana Total RNA isolation kit (Thermo Scientific) on a Kingfisher Flex extraction robot (Thermo Scientific). RNA was reverse transcribed and amplified using the TaqMan RNA-to-CT 1-Step Kit (ThermoFisher). Reverse transcription was carried out at 48°C for 15 min followed by 2 min at 95°C. Amplification was accomplished over 50 cycles as follows: 95°C for 15 s and 60°C for 1 min. Copies of SARS-CoV-2 N gene RNA in samples were determined using a previously published assay (PubMed ID 32553273). Briefly, a TaqMan assay was designed to target a highly conserved region of the N gene (Forward primer: ATGCTGCAATCGTGCTACAA; Reverse primer: GACTGCCGCCTCTGCTC; Probe: /56-FAM/TCAAGGAAC/ZEN/AACATTGCCAA/3IABkFQ/). This region was included in an RNA standard to allow for copy number determination. The reaction mixture contained final concentrations of primers and probe of 500 and 100 nM, respectively.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.