Human collagen type IV alpha 3 binding protein cDNA sequence (hCERTL, 1875 bp NP_005704.1) was cloned into the plasmid AAV-6P-SEW a kind gift of Prof. S. Kugler, Department of Neurology, University of Göttingen. The transgene expression was controlled by a human synapsin-1 promoter (hSYN, 480 bp), and an internal ribosome entry site (IRES 566 bp) enabled the co-expression of EGFP [37]. The plasmid expressing exclusively EGFP was used as a control (pAAV-EGFP). The AAV-CERTL plasmid was sequenced by GATC Biotech laboratories and both AAVs plasmids were tested in vitro. AAVs particles were produced as explained previously [38]. In brief, the transfer plasmids pAAV-EGFP or pAAV-CERTL were used to produce AAV2 particles. Eight 15-cm petri dishes each containing 1.25 × 107 HEK 293 T cells in DMEM containing 10% fetal calf serum (FCS) and 1% Pen/Strep (all GIBCO-Invitrogen Corp., New York, NY, USA) were prepared 1 day before transfection. The medium was refreshed 1 h prior to transfection to Iscove’s modified Eagle medium (IMEM) containing 10% FCS, 1% Pen/Strep, and 1% Glutamine. Transfer plasmids were co-transfected using polyethylenimine (PEI, MV25000; Polysciences Inc.) in a ratio of 1:3 with the pAAV-EGFP or pAAV-CERTL resulting in a total amount of 50 μg of plasmid DNA per plate. The day after transfection, the medium was replaced with fresh IMEM with 10% FCS, 1% PS, and 1% glutamine. Two days later (3 days post-transfection), cells were harvested in Dulbecco-PBS (D-PBS, GIBCO) and lysed with 3 freeze-thaw cycles. Genomic DNA was digested by adding 10 μg/ml DNAseI (Roche Diagnostics GmbH) into the lysate and incubated for 1 h at 37 °C. The crude lysate was cleared by centrifugation at 4000 rpm for 30 min. The virus was purified from the crude lysate using the iodixanol gradient method, diluted in D-PBS/5% sucrose and concentrated using an Amicon 100 kDa MWCO Ultra-15 device (Millipore). All AAV vectors were stored at − 80 °C until use. Titers (genomic copies/ml) were determined by quantitative PCR on viral DNA primers directed against the EGFP portion (Forward: GTCTATATCATGGCCGACAA; Reverse: CTTGAAGTTCACCTTGATGC). The AAV particles produced with pAAV-CERTL are referred to in this paper as AAV-CERTL while the particles produced with pAAV-EGFP are named AAV-control.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.