NCI-H1993 (CRL-5909), NCI-H441 (HTB-174), SKBR3 (HTB-30), MKN-45 (ACC409), OE33 (ACC706), MCF7 (HTB-22), MDA-MB-231 (HTB-26) and NIH3T3 (CRL-1658) cell lines were obtained from ATCC (http://www.lgcstandards-atcc.org/en.aspx) or DSMZ (http://www.dsmz.de/), tested for mycoplasma infection on a regular basis using a commercial biochemical test (Lonza) and authenticated using STR profiling. All cells were cultured in Dulbecco’s Modified Eagle’s Medium/Nutrient Mixture F-12 Ham, 1:1 mixture supplemented with 10% fetal calf serum (FCS), or in case of MKN45 with 20% FCS. Upon serum withdrawal, FCS was replaced by 0.1% bovine serum albumin.

Eight-twelve week-old female severe combined immunodeficiency disease (SCID) mice (Envigo, Italy) were used for xenograft experiments in this study. All animal work was done by following earlier protocols ethically approved by the Institutional Animal Care and Use Committee of the Medical University of Vienna and by the Austrian Bundesministerium für Bildung, Wissenschaft und Forschung (BMWFW-66.009/0081-WF/V/3b/2015).

Formalin fixed paraffin embedded primary tumor samples of advanced stage colorectal carcinoma were obtained from stored samples from de-identified patients treated in Kecskemet General Hospital, Hungary, who had previously provided informed consent for their use in clinical research.

Genomic DNA was isolated from non-stromal regions of 3–4 10 μm thick sections of formalin fixed paraffin-embedded tumors of 49 advanced-stage colorectal carcinoma patients using the Gentra Puregene Tissue Kit (Qiagen) according the manufacturer’s instructions. 60 ng of isolated genomic DNA was used as template in the quantitative real-time PCR reaction. All samples were done in triplicates and the MET and FAM3C copy numbers were derived by standardizing the input DNA to the control signal (TOP3A, chromosome 17p11) as described earlier [15]. The sequences of the primer pairs and probes for TOP3A and MET were as described in [16] using FAM as flourogenic label. For FAM3C the primers Hsp.FAM3C_F 5′-GTCACACTCTTGTGCCAGTCT-3′ and Hsp.FAM3C_R 5′-GAGCAAAGGTCAGGGTTGAAAG-3′ were used with the HEX-labeled probe Hsp.FAM3C_probe 5′-TCTGCAGCTTCAAATCCCCTCCTG-3′ allowing duplex PCR with the TOP3A control gene.

Gene CNs of FAM3C, MET, EGFR, and FGFR1 were calculated using the genome sequencing datasets of several cancer entities in the TCGA database (https://www.cancer.gov/about-nci/organization/ccg/research/structural-genomics/tcga). GISTIC 2.0 values were obtained from the Firehose system using Caleydo v3 software (caleydo.org): − 2, deep deletion; − 1, shallow deletion; 0, diploid; 1, gain; 2, amplification. RNA-seq data were obtained from Cancer Browser database (https://genome-cancer.ucsc.edu/).

Copy number (CN) data of 200 tumor cell lines were generated using the GeneChip Human Mapping 250 K Nsp Arrays (Affymetrix) and subsequently analyzed on the Affymetrix® Genotyping Console™ software (GTC) using the unpaired CNAT 4.0 analysis algotrythms. Gene copy number ± 3 was considered as amplification, < 3 as non-amplified.

For ILEI and mammalian non-targeting control shRNA knock-down in NCI-H1993, NCI-H441, MKN45, OE33 and SKBR3 cells, MISSION shRNA lentiviral transduction particles (Sigma, St Louis, MS, USA) were used according to the manufacturer’s instructions. Five shRNA sequences were pretested for ILEI knock-down (sh261 CCGGGATGCAAGTTTAGGAAATCTACTCGAGTAGATTTCCTAAACTTGCATCTTTTTG, sh328 CCGGCCAGATATAAGTGTGGGATCTCTCGAGAGATCCCACACTTATATCTGGTTTTTG, sh506 CCGGAGGAGAAGTATTAGACACTAACTCGAGTTAGTGTCTAATACTTCTCCTTTTTTG, sh579 CCGGGCCATACAAGATGGAACAATACTCGAGTATTGTTCCATCTTGTATGGCTTTTTG and sh1767 CCGGCCTGTGTTTATCTAACTTCATCTCGAGATGAAGTTAGATAAACACAGGTTTTTG) and two were selected (sh261 and sh506) as the most efficient for later studies. In studies with only one shILEI cell line, “shILEI” indicates sh506. Stable cell lines were established using selection for puromycin resistance of transduced cells. ILEI expression was validated in whole cell lysates and conditioned medium (CM) by Western blotting.

Western blot analysis was performed as previously described [13]. Cells were treated with crizotinib (500 nM), savolitinib (1 μM, both dissolved in DMSO) or DMSO for 24 h, conditioned media (CM) were collected after 24 h. Anti-ILEI [6], anti-phospho cMET (#3077), anti-cMET (#3127), anti-phosphoErk1/2, anti-Erk1/2, anti-E-cadherin, anti-vinculin (Cell Signaling Technologies), anti-α tubulin, and anti-β actin (Sigma) primary antibodies were used followed by enhanced chemiluminescent (ECL) detection using Chemidoc Touch (Bio-Rad) for digital capturing and ImageLab software (Bio-Rad) for visualization and quantification.

Cells were pretreated with different concentrations of crizotinib for 24 h and seeded in triplicates in 96 well plates in the presence of the same inhibitor concentrations. After 24 h of incubation, cells were labeled with 30 μCi/ml methyl 3H-thymidine for 2 h. Radioactive media was removed, cells were washed in phosphate-buffered saline (PBS) and trypsinized. Cells were fixed by Tomtec cell harvester (Tomtec Inc., USA) onto a wax-embedded filtermat, and radioactive intensity was determined by a Wallac 1450 MicroBeta liquid scintillator (PerkinElmer Inc., USA). Results were normalized according to cell number.

Cells were plated in 100 μl complete medium in 96-well flat bottom plates in the presence or absence of crizotinib (500 nM) or vehicle (DMSO) or increasing concentrations of PHA665752 (Sigma) and Savolitinib (Selleckchem). After 24 h (crizotinib) or 72 h (PHA665752, savolitinib) of incubation 10 μl of 5 mg/ml 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) solution dissolved in PBS was added for 2 h followed by the addition of 100 μl of solubilization solution (40% dimethylformamide, 2% acetic acid, 16% sodium dodecyl sulfate, pH 4.7) and rigorous shaking to dissolve the formazan crystals. The absorbance at 570 nm was determined using a Tecan plate reader (Tecan, Austria). Triplicate wells were assayed for each condition.

Cells were pre-starved overnight in starvation or low (1%) FCS medium and seeded in the same medium into trans-well invasion chambers with 8 μm pore size, coated with Matrigel (Corning Inc., USA) and pre-equilibrated with medium (50.000 cells/inlet, each condition in triplicates). The lower chamber of the trans-well unit contained conditioned medium of NIH3T3 cells or human HGF (40 ng/ml) as attractant. For c-MET inhibition, medium was supplemented with 500 nM crizotinib both in the upper and lower chambers. Cells were allowed to invade for 24 h, non-invaded cells were removed from the upper side of the inlets, and cells were fixed and stained with 4′,6-diamidino-2-phenylindole (DAPI). Total numbers of invasive cells were counted using fluorescent microscopy imaging followed by ImageJ analysis.

Total RNA was extracted, reverse transcribed and cDNA was amplified with primers for the genes MMP9, MMP2 and CDH1 as described earlier [17].

For MMP-9 and MMP-2 detection in the CM of NCI-H441 and NCI-H1993 shCont and shILEI cells upon HGF stimulus with or without crizotinib treatment cells were plated in 6-well plates. At 70–80% confluency, cells were crizotinib- (500 nM) or DMSO-treated for 30 min followed by medium change to FBS-free media with continued crizotinib supply and the addition of human HGF (40 ng/ml). 24-h CM were collected and concentrated as described for Western blot analysis and all samples were adjusted to the same protein concentration followed by equal volume gel loading.

For MMP-9 and MMP-2 detection in protein extracts, NCI-H441 and NCI-H1993 shCont and shILEI snap-frozen tumor pieces with or without crizotinib treatment were homogenized in lysis buffer (see Western blot analysis for composition), total protein concentration was determined and equal protein amounts were loaded.

A 7.5% acrylamide gel was prepared with 2 mg/ml final concentration of gelatin; samples were loaded in non-reducing sample buffer without boiling. After running, the gel was washed twice for 30 min each in washing buffer (2.5% Triton X-100, 50 mM TRIS-HCl, pH 7.5, 5 mM CaCl2, 1 μM ZnCl2), rinsed for 10 min in incubation buffer (1% Triton X-100, 50 mM TRIS-HCl, pH 7.5, 5 mM CaCl2, 1 μM ZnCl2) at 37 °C followed by incubation in fresh incubation buffer for 24–40 h at 37 °C. The gel was stained in staining solution (0.5% (w/v) Coomassie Blue, 10% acetic acid, 40% methanol) for 1 h, rinsed with water and incubated in destaining solution (10% acetic acid, 40% methanol) until white bands were clearly visible. 10 ng of recombinant MMP-9 (Thermofisher Scientific) was loaded as positive control. Gels were quantified using ImageJ.

Immunohistochemistry on paraformaldehyde fixed, paraffin embedded, 3 μm thick sections of mouse tumor tissues was performed manually using anti-Ki67 (1:2000), anti-CD31 (1:200) (abcam), anti-cleaved Caspase3 (1:1000), anti-phospho cMET (1:1000), anti-cMET (1:1000), anti-MMP9 (1:1000) (Cell Signaling Technologies), anti-E-cadherin (1:1000) (BD Biosciences) and anti-ILEI (1:1000) [6] primary antibodies and Lab Vision™ UltraVision™ LP Detection System (Thermo Scientific) with 3,3′-diaminobenzidine (DAB) substrate (Dako) for detection according to the manufacturer’s instruction. Cell nuclei were visualized by hematoxylin staining. Histological samples were scanned using a Pannoramic MIDI slide scanner (3D Histech) with a 40X objective. Subsequently, quantification of immunomhistochemistry was performed by the histomorphometric software package Tissue Studio® (Definiens AG). The E-cadherin membrane score was obtained by the formula: 3 x ratio of high membrane staining intensity + 2 x ratio of medium membrane staining intensity +1x ratio of low membrane staining intensity, giving a range of 1 to 3.

Mouse xenografts were established with subcutaneous injection of 1.7 × 106 control (shCont) or ILEI KD (sh506) NCI-H1993 and NCI-H441 cells into 8–12-week old female SCID mice (n = 4). Injected mice were distributed into randomized cohorts and vehicle and compound treatment started as the mean tumor size reached 100 mm3. Crizotinib (LC Laboratories) was applied orally (50 mg/kg, dissolved in 5% DMSO, 10% ethanol and 10% Cremophor) in a 5-days treatment 2-days pause protocol. For NCI-H1993 tumors, at the time point of sacrifice of vehicle-treated mice, crizotinib treated animals were monitored for an additional 11 days without further supply of the compound. Tumors were measured regularly by a caliper and tumor volume was calculated by the formula a x b2 / 2 (a for the major and b for the minor tumor diameter). The tumors were dissected, and tumor mass was determined 40–50 days after injection.

Data are expressed as the mean ± standard error of the mean (SEM) where applicable. Data normality was checked using Shapiro-Wilk and Kolmogorov-Smirnov tests. Statistical significance was determined by unpaired two-sided Student’s t-test, one-way and two-way analysis of variance (ANOVA) tests and Kruskal-Wallis tests followed by Dunn’s multiple testing adjustment using Graph Prism software (version 5.0). Survival differences were calculated using log rank tests. p < 0.05 was considered significant. Kendall’s tau-b tests and Chi-square tests were calculated using R software (version 3.2.1). Alluvial plots were generated using Caleydo 3.0 software [18].

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.