The full-length MaPOD P7 and MaICE1 homolog open reading frame was amplified with the following primers set: forward (5′-ggtgagctcggtaccaagctt ATGGCCACCTCCTGGAGAAGCTG-3′)/reverse (5′-agcggccgcactagtaagctt GTTCA CCTTCCTGCAATCCAACCT-3′) and forward (5′- ggtgagctcggtaccaagctt ATGCTCTCGGGGATCAATGG-3′)/reverse (5′-agcggccgcacta-gtaagcttTGACACT GTATTATCGAAGCCGG-3′) respectively, and then introduced into the pMD18-T vector for sequencing. The right MaPOD P7 open reading frame fragment was collected and subcloned into the pRTVnVC vector containing a red fluorescent protein (mCherry) reporter gene (digested with Hind III in advance) to produce the fusion construct Ubi: POD-mVenusC under control of the Ubi promoter by using a One Step Cloning Kit (Vazyme Biotech, Nanjing, China). In the same way, the right MaICE1 open reading frame fragment was collected and subcloned into the pRTVnVN vector containing CFP protein reporter gene to produce the fusion construct Ubi: ICE1-mVenusN. The BiFC system used in this study was as described previously with slight modifications [74]. For the interaction studies, protoplasts (100 μl) (1.5–2 × 106 cells) were transformed with 5–10 μg of plasmids (Ubi:ICE1-mVenusN + Ubi:POD-mVenusC) by the polyethylene glycol (PEG) method with minor modifications [75]. The protoplasts were incubated at 30 °C for 15 h. The localization or co-localization of mVenus proteins and their markers was assessed with a confocal microscope (Olympus BX61, Tokyo, Japan). The full-length CDS of MaMAPK3 was introduced into pRTVnVC vector, and the full-length CDS of MaICE1 was cloned into pRTVnVN vector. Protoplast isolation and transient expression were carried out as previously described. Empty vectors were co-transformed as negative controls.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.