The Lentiviral Human RNF152 shRNAs were purchased from Merck (Sigma) and the target sequences for short hairpin RNA (sh-RNA)-expressing plasmids were the following: RNF152-shRNA1:5′CCGGATGTCAGATCTGTTTCAATTACTCGAGTAATTGAAACAGATCTGACATTTTTTTG-3′; RNF152-shRNA2: 5′-CCGGCTTCACAACATGTCTTGCATTCTCGAGAATGC.

AAGACATGTTGTGAAGTTTTT-3′. RNF152-shRNA3: 5′-CCGGGCCCAAGTTGCTGGACTGCAACTCGAGTTGCAGTCCAGCAACTTGGGCTTTTT-3.

TSPAN12-shRNA: 5′-CCGGCATCCGGTCATGATTGCTGTTCTCGAGAACAGCAATCATG.

ACCGGATGTTTTTTG-3′. Total RNA of cell lysate was extracted by using TRIzol reagent (Invitrogen, Shanghai). Oligo dT was used to prime cDNA synthesis. Real-time PCR was then performed by using a SYBR Green Premix Ex Taq (TaKaRa) on Light Cycler480 (Roche, Switzerland) under the following conditions: 95 °C for 3 min, followed by denaturation at 94 °C for 15 s, annealing at 55 °C for 25 s and extension at 72 °C for 15 s for 35 cycles. The relative differences in mRNA levels were calculated by 2−ΔΔCT method. GAPDH was used as internal control. Differences in gene expression were calculated using 2−ΔΔCt method. Primers used for qPCR analysis were list as follows: RNF152 forward, 5′-GGAGACCGCATTCCCTTGG-3′; reverse, 5′-AAAACCGATTGGGCATAAGCC-3′. TSPAN12 forward, 5′-TGTGTCTTTGCAGTGCAGGT-3′; reverse, 5′-GGGTGAAAGAGACTCGGTGA-3′. CXCL6 forward, 5′-CCCACTGGCCTCTGATAAAGG-3′; reverse, 5′-ACGCAAAGGTGCATGATTTG-3′. GAPDH forward, 5′-TGTGGGCATCAATGGATTTGG-3′; reverse, 5′-ACACCATGTATTCCGGGTCAAT-3′.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.