The amplification of the hypervariable ITS3–4 region of the ITS rRNA gene was carried out using fungal primers set ITS3F (GCATCGATGAAGAACGCAGC) and ITS4R (TCCTCCGCTTATTGATATGC) [76]. The PCR reactions were carried out in a 50 μL mixture with 1 mM dNTPs, 1× PCR buffer, 1 U Platinum Taq, 5 μM per primer, and 10 ng of template DNA. The PCR amplification included an initial denaturation at 94 °C for 3 min, denaturation (5 cycles at 94 °C) for 30 s, annealing at 45 °C for 20 s, extension at 65 °C for 30 s, denaturation (20 cycles at 94 °C) for 20 s, annealing at 55 °C for 20 s, extension at 72 °C for 30 s and a final extension at 72 °C for 5 min. After purification and quantification, the PCR product of the ITS3–4 region of the ITS rRNA gene was determined by pyrosequencing using an Illumina MiSeq sequencer (Sangon Biotech Shanghai Co., Ltd., China) [18, 77].

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.