The total RNA was isolated from the cells with TRIzol® reagent according to the manufacturer's instructions. The concentration and purity of the RNA were determined by spectrophotometry (A260:A280). The GoScript™ Reverse Transcription System (Promega, cat#: A5001, USA) was applied to synthesize cDNA according to the manufacturer's protocol. Briefly, the total RNA (2 μg) was used in reverse transcription reactions in a total volume of 20 μl with the following three-step incubation: 25°C for 5 min, 42°C for 60 min, and 70°C for 15 min. For amplification, the mixture, which comprised the cDNA sample (2 µl), gene-specific primers (2 µl), 2×Taq PCR MasterMix (TIANGEN, cat#: KT201, China; 12.5 µl) and ddH2O (8.5 µl), was incubated at 94°C for 3 min before being subjected to 40 cycles that consisted of 94°C for 30 s, 60°C for 30 s, and 72°C for30 s, followed by a final elongation phase at 72°C for 10 min. The RNA was visualized by agarose-formaldehyde gel electrophoresis, and Goldview™ (1:10000) was added to the gel before solidification. The sequences of the primers were as follows: AR forward, 5′ GGACGACCAGATGGCTGTCATTC 3′ and reverse, 5′ GCGAAGTAGAGCATCCTGGAGTTG 3′; GAPDH forward, 5′ TGACTTCAACAGCGACACCCA 3′ and reverse, 5′ CACCCTGTTGCTGTAGCCAAA 3′.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.