Primary myoblasts were maintained in a myoblast medium: DMEM/F‐12, HEPES (31330–038, Thermo Fisher Scientific) supplemented with 10% foetal bovine serum (Hyclone, Logan, UT), 10 ng/mL fibroblast growth factor 2 (FGF2, 100‐18B, Peprotech), and 50 nM dexamethasone (D4902, Sigma‐Aldrich) on 0.1% gelatin‐coated (G1393, Sigma‐Aldrich) cultureware.

Primary myoblasts were differentiated into myotubes. Cells were seeded at 600 cells/cm2 on 0.1% gelatin‐coated cultureware in myoblast medium containing 1 mM acid ascorbic 2P (A8960, Sigma‐Aldrich).

Primary myoblasts were reprogrammed into hiPSCs following the protocol described in Massouridès et al., 15 using the Yamanaka's factors POU5F1, SOX2, cMYC and KLF4 transduction by ecotropic or amphotropic vectors (Table S1). HiPSCs and human embryonic stem cells (hESCs) were adapted and maintained with mTeSR™1 culture medium (05850, Stemcell Technologies) on Corning® Matrigel® Basement Membrane Matrix coated cultureware (354234, Corning Incorporated). Cells were then seeded at 20 000 cells/cm2, passaged, and thawed each time with 10 μM StemMACS™ Y27632.

Six hiPSCs (three healthy and three DMD) were differentiated three times towards skeletal muscle lineage using commercial media designed from the work of Caron et al. 23 (Skeletal Muscle Induction medium SKM01, Myoblast Cell Culture Medium SKM02, Myotube Cell Culture Medium SKM03, AMSbio). This protocol is a 2D directed differentiation that uses three consecutive defined media (SKM01 from Day 0 to 10, SKM02 from Day 10 to 17, and SKM03 from Day 17 to 25) and only one cell passage at Day 10. Cells were seeded at 3500 cells/cm2 at Day 0 and Day 10 on BioCoat™ Collagen I cultureware (356485, Corning Incorporated). Part of the cell culture was frozen at Day 17 for further experiments such as DNA extraction. These cells were then thawed at 30 000 cells/cm2 and cultured in SKM02 for 3 days and SKM03 for 3 additional days to get myotubes. Two isogenic hESCs (one healthy and one DMD) were differentiated two times using the same protocol.

Exon 52 of the DMD gene was removed by gene editing. Benchling and Crispor software were used to design the single guide (sg) RNAs upstream and downstream of DMD exon 52 (sgRNA sequences are followed by scaffold sequences, which are underlined; upstream: GTTTGGTGATTCTTACGGACGTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT; downstream: GCCCACCCTACTACGGCATAGTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT). SgRNAs were diluted at 150 pmol/μL in TE 1X buffer and then at 30 pmol/μL in nuclease‐free water. The ribonucleoprotein complex was formed in 25 μL, with 20 pmol of Cas9 2NLS nuclease (S. pyrogenes, Synthego) mixed to 90 pmol of each diluted sgRNAs in P3 solution (V4XP‐3024, Lonza), incubated at room temperature for 10 min before being stored at 4°C. After an amplification in mTeSR™1 culture medium (05850, Stemcell Technologies) on Corning® Matrigel® Basement Membrane Matrix coated cultureware, SA001 hESCs (Cellartis) were harvested and passed through a sieve (40 μm, Falcon). A total of 150 000 cells were centrifuged for 5 min at 90 g, resuspended in 5 μL of P3 solution, and mixed to the complex. The resulting 30 μL were then transferred to a 16‐well Nucleocuvette™ Strip processed with the 4D‐Nucleofector System™ (Lonza) to introduce the complex into cells by electroporation (CD118 program). Cells were then seeded at a non‐clonal density in pre‐warmed mTeSR™1 culture medium with 10 μM Rock Inhibitor on Corning® Matrigel® Basement Membrane Matrix coated 24‐well cultureware. One well was used 48 h later to do DNA extraction (QuickExtract™ DNA, Lucigen) and validate the deletion by PCR [using Q5® High‐Fidelity DNA Polymerase (New England Biolabs) and DMD Delta exon 52 primers (Table S2); with the program: 95°C for 5 min; for 35 cycles: 95°C for 30 s, 64°C for 30 s, 72°C for 39 s; and 72°C for 2 min; amplicon of 893 pb]. Seventy‐six hours after the CRISPR, one well was used for cell banking and another was used to be seeded into 96‐well plates at a clonal density with cloneR (#05888, Stemcell Technologies) addition and a medium change after 2 days. The first half of each colony was used after 15 days of culture for amplification, while the other half was processed for PCR analysis. Eurofins Genomics performed the sequencing of the selected clone. The resulting sequence was analysed with Benchling, NCBI (BLASTn), and Biomanda: the DMD Delta52 cell line had a deletion of 1161 base pair (bp) containing the targeted exon 52 (118 pb) and an insertion of a random sequence of 6 bp.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.