Total RNA was extracted from frozen tissues or cell lines using TRIzol reagent (Life Technologies, USA). RNA concentrations were measured using a NanoDrop ND-2000 spectrophotometer (NanoDrop Technologies, Wilmington, DE). RNA was reverse-transcribed to cDNA using a reverse transcription kit (Takara, Tokyo, Japan). qRT‐PCR was performed using the SYBR qPCR Master Mix (Vazyme, China), according to the manufacturer's instructions. The primer sequences were: SNHG25 forward primer 5′‐GCAGGTTCCGGGAGGTCA‐3′, SNHG25 reverse primer 5′‐CAAACCACTTTATTGACGGGAA‐3′, GAPDH forward primer 5′-AGAAGGCTGGGGCTCATTTG-3′, GAPDH reverse primer 5′‐AGGGGCCATCCACAGTCTTC‐3′, COMP forward primer 5′‐GGAGATGCTTGTGACAGCGATC‐3′, COMP reverse primer 5′‐TGAGTCCTCCTGGGCACTGTTA‐3′.

Parameters were: pre-denaturation at 95 °C for 10 min for 1 cycle, denaturation at 95 °C for 30 s, annealing at 60 °C for 1 min, and extension at 60 °C for 30 s for a total of 40 cycles. The house keeping gene GAPDH (glyceraldehyde-3-phosphate dehydrogenase) was used as an internal control. The fold change in the expression of target genes was calculated with the 2-ΔΔCT method.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.