Tissue Distribution of Tilapia Gcga, Gcgb, Gcgra, and Gcgrb

The tissue distributions of Gcgs and Gcgrs were examined using qPCR. The selected tissues included fat, hypothalamus, intestine, kidney, liver, muscle, pituitary, stomach, and testis. To detect Gcgra and Gcgrb mRNA expression at the pituitary level, the NIL and pars distalis (PD) of individual pituitaries were isolated by manual dissection under a stereomicroscope as described previously (30). Total RNA was isolated from different tissues of the six male tilapia using TRIzol reagent (Invitrogen) followed by chloroform/isopropanol extraction. RNA was quantified using NanoDrop 1000 spectrophotometer (Thermo Scientific), and 1 µg of total RNA was reverse transcribed using iScript™ Reverse Transcription Supermix (Bio-Rad). qPCR assays were performed on a Mastercycler® ep realplex system (Eppendorf) and analyzed using the software Realplex 2.2 (Eppendorf). qPCR reaction was conducted with a SYBR Select Master Mix kit (Invitrogen) using the primers specific for tilapia Gcga [forward primer: 5’ GACGAGCCTGTGGAGTTGTC 3’ and reverse primer: 5’ GCAGCACCACTCCTCTTGTT 3’], Gcgb [forward primer: 5’ TCATCATTCAAAGCAGCTGGCA 3’ and reverse primer: 5’ CGTGGCGTCTCCCATTCCTT 3’], Gcgra [forward primer: 5’ TGGATCATACGCGCTCCGAT 3’ and reverse primer: 5’ TCGACTTAGCCAACCGGAAC 3’], Gcgrb [forward primer: 5’ CCGCTCATATTTGTGTTGCCAT 3’ and reverse primer: 5’ CGGATAATCCACCAATATCCCA 3’]. The qPCR conditions were the following: 2 min incubation at 95°C, 35 amplification cycles (95°C for 30 s, 56°C for 30 s, and 30 s at 72°C, with fluorescence signal detection at the end of each cycle), followed by melting curve of the amplified products obtained by ramped increase of the temperature from 55 to 95°C to confirm the presence of single amplification product per reaction. As an internal control, qPCR for β-actin was conducted using the primers specific for β-actin [forward primer: 5’ GTGATGGTGGGTATGGGT 3’ and reverse primer: 5’ GGCAACTCTCAGCTCGTT 3’]. In these experiments, β-actin was used as an internal control for normalizing genes of interest, and gene expression levels were analyzed using the 2−ΔΔCT method.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.