SLEV load in cell culture and tissue samples was determined by plaque assay and/or reverse transcriptase quantitative PCR (RT-qPCR). Tissue samples were processed into 10% w/v homogenates in DMEM prior to analysis by both techniques. Briefly, the plaque assay consisted in the serial dilution of samples for adsorption in Vero cell monolayers, for an hour. Samples were removed, following the addition of an overlay media containing 1.5% w/v carboxymethylcellulose (Synth, SP, Brazil) in 2% fetal bovine serum (FBS) v/v DMEM. After 7 days, plates were fixed, washed and stained with Methylene blue (Synth, SP, Brazil) 1% w/v. Results were expressed as plaque-forming units (PFU)/mL of supernatant or PFU/100 mg of tissue. For the RT-qPCR reaction, samples were submitted to RNA extraction (QIAamp viral RNA extraction kit, QIAgen) and cDNA synthesis using Random primers (Promega) and SuperScript Reverse Transcriptase III (Invitrogen), according to the companies’ specifications. The qPCR reaction was performed in the 7500 Fast platform using SYBR green reagents (Applied Biosystems) and primers targeting SLEV NS5 gene (primer forward FG1 TCAAGGAACTCCACACATGAGATGTACT, primer reverse nSLE ATTCTTCTCTC AATCTCCGT), as described elsewhere [31]. All PCR reactions were accompanied by a standard curve of the 232bp NS5 amplicon. Results were expressed as relative number of genome copies of SLEV per sample.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.