Double-stranded RNA (dsRNA) for Smed-egfr-3 and Smed-aqp-(1–7) were synthesized as previously described (Smed-egfr-3, forward primer: GTACTGGGCAATGTTGGACCTGGC, reverse primer: TGACGGCCTCATGTGGGGATCATCG; Smed-aqp-1, forward primer: GCAGAACTTCTTGGCACCTT, reverse primer: CCCACTATTGGTATCATGGC; Smed-aqp-2, forward primer: TTTTGGTTGTCAGTGGTCGC, reverse primer: CGGAAGAGGGAAAACTGACG; Smed-aqp-3, forward primer: TTGCCTCAATCGGTCGTTTG, reverse primer: ATGCTCCGAAAACTCCTCCA; Smed-aqp-4, forward primer: CGTGGGTCCAATTTCAGG, reverse primer: GGGTACTTTCTATTCGTGAAG; Smed-aqp-5, forward primer: GACACATCAATCCAGCCGTC, reverse primer: CGTCATACCGATCAGCCTTT; Smed-aqp-6, forward primer: CGTTGAATTCCTAGGAACTTTC, reverse primer: GCCACAATGTTGAGCAATGAC; Smed-aqp-7, forward primer: TTCCCTTCACCAACAGCAGG, reverse primer: CCGTGAGCAACGGCAACGGC). Animals were injected in two rounds of 3 consecutive days each with 4 days elapsed in between. On day 4 of the second round, planarians were amputated pre- and post-pharyngeally to induce regeneration. Injections were done using the Nanoject II (Drummond Scientific, Broomall, PA, USA) and consisted of three times 32 nl containing 1 μg/μl dsRNA71. Controls were injected with dsRNA of gfp.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.